Contact Name
Contact Email
Journal Mail Official
Editorial Address
Kab. sumedang,
Jawa barat
Majalah Kedokteran Bandung
ISSN : -     EISSN : -     DOI : -
Core Subject : Health,
Arjuna Subject : -
Articles 8 Documents
Search results for , issue " Vol 42, No 3 (2010)" : 8 Documents clear
Radiasi Eksternal Karsinoma Nasofaring sebagai Penyebab Gangguan Dengar Sensorineural Haryanto, Rakhmat; Saefuddin, Ongka M.; Boesoirie, Thaufiq S.
Majalah Kedokteran Bandung Vol 42, No 3 (2010)
Publisher : Fakultas Kedokteran, Universitas Padjadjaran

Show Abstract | Download Original | Original Source | Check in Google Scholar


Radiasi berperan penting pada pengobatan kanker kepala leher karena reseksi bedah sering tidak memungkinkan, tetapi menimbulkan efek samping gangguan dengar sensorineural. Penelitian observasional rancangan longitudinal ini untuk mengetahui pengaruh radiasi terhadap gangguan dengar sensorineural penderita karsinoma nasofaring di Bagian THT-KL Rumah Sakit Hasan Sadikin Bandung periode Februari–Agustus 2006. Didapatkan 28 laki-laki dan 7 perempuan, yang satu atau kedua telinganya tidak terganggu pendengaran sensorineural, usia 12–72 tahun, dan memenuhi kriteria inklusi. Seluruh penderita mendapat radiasi dan pemeriksaan audiometri serta timpanometri sebelum, durante 2.000 cGy, 6.600 cGy, dan satu bulan pascaradiasi. Data dianalisis secara statistik menggunakan uji Chi-kuadrat, Mc-Nemar, dan eksak Fisher. Hasil penelitian menunjukkan kejadian gangguan dengar sensorineural durante 2.000 cGy adalah 7 kasus (10%), 6.600 cGy 22 kasus (31,4%), dan pascaradiasi 24 kasus (34,3%). Hubungan antara durante 6.600 cGy dan 2.000 cGy pada kelompok preradiasi normal sangat bermakna (p=0,001), sedangkan antara pascaradiasi dan durante 6.600 cGy tidak bermakna (p= 0,5). Pada usia >30 tahun gangguan dengar sensorineural 37,0% durante 6.600 cGy (p=0,031) dan 40,7% pascaradiasi (p=0,018). Simpulan, radiasi karsinoma nasofaring dapat menyebabkan gangguan dengar sensorineural selama dan pascaradiasi, serta usia >30 tahun merupakan faktor prognosis gangguan dengar sensorineural. [MKB. 2010;42(3):108-14].Kata kunci: Gangguan dengar sensorineural, karsinoma nasofaring, radiasiNasopharyngeal Carcinoma External Radiation As Causal of Sensorineural Hearing LossRadiation has an important role on nasopharyngeal carcinoma therapy because surgery is often difficult, however it cause sensorineural hearing loss as side effect. Longitudinal observational study was conducted to know the effect of radiation on sensorineural hearing loss of nasopharyngeal carcinoma patients at Ear, Nose, and Throat Department, Hasan Sadikin Hospital, February-August 2006. Twenty eight male and 7 female, with no sensorineural hearing loss in one or both ears, age 12–72 years, and met inclusion criteria, were included in this study. All patients received >radiation and underwent audiometry and tympanometry prior-,during-radiation with a 2.000 cGy and 6,600 cGy, and one month postradiation. Data was analyzed using Chi-square, Mc-Nemar, and exact Fisher test. The results showed that incidence of sensorineural hearing loss were 7 cases (10%) on 2,000 cGy, 22 cases (31.4%) on 6,600 cGy, and 24 cases (34.3%) on postradiation. The relationship between duration 6,600 cGy and 2,000 cGy in the normal preradiation group were significant (p= 0.001), whereas postradiation and duration with 6,600 cGy was not significant (p= 0.5). Sensorineural hearing loss on >30 years was 37.0% on duration 6,600 cGy (p=0.031) and 40.7% postradiation (p=0.018). In conclusion, radiation on nasopharyngeal carcinoma can induce sensorineural hearing loss during- or postradiation and age >30 years is prognostic factor for sensorineural hearing loss. [MKB. 2010;42(3):108-14].Key words: Nasopharyngeal carcinoma, radiation, sensorineural hearing loss
Polimorfisme C1167T Gen Reseptor Tipe II Transforming Growth Factor-â, Kadar Soluble Endoglin, dan Vascular Cell Adhesion Molecule-1 pada Preeklamsia Anwar, Anita D.; Achmad, Tri Hanggono; Sukandar, Hadyana; Krisnadi, Sofie R.; Wirakusumah, Firman F.
Majalah Kedokteran Bandung Vol 42, No 3 (2010)
Publisher : Fakultas Kedokteran, Universitas Padjadjaran

Show Abstract | Download Original | Original Source | Check in Google Scholar


Transforming growth factor-â (TGF-â) diduga berperan pada preeklamsia. Reseptor TGF-â tipe II (TâR-II) dihasilkan dari transkripsi gen TGF-â receptor type II (TGFBR2). Polimorfisme gen TGFBR2 pada basa C1167T dapat menyebabkan hipoksia yang menginduksi iskemia serta meningkatkan produksi solubel endoglin (sEng) dan vascular cell adhesion molecule-1 (VCAM-1). Tujuan penelitian ini untuk mengetahui korelasi polimorfisme gen TGFBR2 pada basa C1167T dengan kadar sEng dan VCAM-1 ibu preeklamsia. Subjek adalah ibu preeklamsia usia kehamilan 28–42 minggu dan kehamilan normal sebagai kontrol, masing-masing 120 orang. Penelitian dilakukan di Rumah Sakit Hasan Sadikin, Bandung, September 2008–Mei 2009. Sampel berupa darah vena, pemeriksaan polimorfisme dilakukan dengan DNA Wizard® genomic DNA purification, kadar sEng dan VCAM-1 dengan imunoesai. Hasil penelitian menunjukkan polimorfisme CT pada kelompok preeklamsia 92 (76,7%) dan kontrol 70 (58,3%) {p<0,001; OR (95%CI): 2,35 (1,30–4,26)}. Kadar sEng (ng/mL) 12,46 berbanding 10,29 pada kelompok kontrol {p<0,001; OR (95%CI): 3,71 (2,11–6,57)}. Kadar VCAM-1 berbeda bermakna, yaitu 1.218,43 berbanding 705,59 {(p<0,001; OR (95%CI): 7,56 (4,11–14,0)}. Disimpulkan terdapat perbedaan proporsi dan korelasi polimorfisme C1167T gen TGFBR2, kadar sEng, dan VCAM-1 antara preeklamsia dan kehamilan normal. [MKB. 2010;42(3):115-22].Kata kunci: Polimorfisme gen TGFBR2, preeklamsia, sEng, VCAM-1C1167T Type II Transforming Growth Factor-â Receptor Gene Polymorphism, Soluble Endoglin and Vascular Cell Adhesion Molecule-1Levels in PreeclampsiaTransforming growth factor-â (TGF-â) plays a role in preeclampsia. TGF-â receptor type II (TâR-II) is produced from the transcription of the type II TGF-â receptor gene (TGFBR2). Polymorphism of TGFBR2 gene on the base C1167T could cause hipoxia that induces ischaemia and product soluble endoglin (sEng) and vascular cell adhesion molecule-1 (VCAM-1). The aim was to find out the association of C1167T type II TGF-â receptor gene polymorphism with sEng and VCAM-1 levels in preeclampsia. The study was done at Hasan Sadikin Hospital, Bandung, September 2008–May 2009. Indicates that C1167T polymorphism events were found in the preeclampsia that were 92(76.7%) of 120 cases and 70 (58.3%) control of 120 normal pregnancies with the difference in the appearance polymorphism which means p<0.001 OR (95%CI):2,35 (1.30–4.26). There was a difference between sEng (ng/μL) 12.46 for preeclampsia and 10.29 for the control group p<0.001 OR (95%CI): 3.71 (2.11–6.57). There was also a difference between VCAM-1 (ng/μL) 1,218.43 for the preeclampsia and 705.59 for the control group {p<0.001 OR (95%CI): 7.56 (4.11–14.0)}. There was a result that in preeclamptic patient having polymorphism sEng level was 14.19 ng/mL and VCAM-1 level is 961,85 ng/mL. It is concluded that there are difference proportion and association of C1167T type II TGF-â receptor gene polymorphism with sEng and VCAM-1 levels between preeclampsia and normal pregnancy patients. [MKB. 2010;42(3):115-22].Key words: Preeclampsia, sEng, TGFBR2 gene polymorphism, VCAM-1
Kapasitas Fungsi Intelektual pada Berbagai Kelompok Interaksi Sosial Anak Autis Moekdas, Raddi; Sukadi, Abdurachman; Yuniati, Tetty
Majalah Kedokteran Bandung Vol 42, No 3 (2010)
Publisher : Fakultas Kedokteran, Universitas Padjadjaran

Show Abstract | Download Original | Original Source | Check in Google Scholar


Autis dikelompokkan berdasarkan interaksi sosial dan kapasitas fungsi intelektual. Penelitian ini bertujuan untuk mengetahui hubungan antara kelompok interaksi sosial dan kapasitas fungsi intelektual. Penelitian dilakukan Januari–Maret 2007 pada anak autis di pusat terapi Our Dream dan Indigrow Bandung dengan rancangan hybride selective prevalence. Anak autis dikelompokkan berdasarkan interaksi sosial serta kapasitas fungsi intelektual. Usia dan riwayat terapi perilaku merupakan faktor perancu kelompok interaksi sosial. Uji statistik pada penelitian ini menggunakan Kruskall-Wallis dan Kolmogorov-Smirnov dua populasi. Subjek penelitian yang memenuhi kriteria inklusi berjumlah 99 anak. Kelompok aloof, pasif, aktif tetapi aneh masing-masing sebanyak dua, 31, dan 66 anak autis. Kapasitas fungsi intelektual rendah sebanyak 70 dan tinggi 29 anak autis. Usia £5 dan >5 tahun ditemukan pada 58 dan 41 anak autis (pKW= 0,453). Riwayat pernah dan belum pernah mendapat terapi perilaku ditemukan pada 37 dan 62 anak autis (pKS = 1,00). Didapatkan 70 anak (71%) memiliki kapasitas fungsi intelektual rendah dan 29 anak (29%) dengan kapasitas fungsi intelektual tinggi. Kelompok interaksi sosial berhubungan bermakna dengan kapasitas fungsi intelektual anak autis (p= 0,04). Disimpulkan bahwa kelompok interaksi sosial aloof, pasif dan aktif tetapi aneh berhubungan dengan kapasitas fungsi intelektual rendah dan tinggi. [MKB. 2010;42(3):96-100].Kata kunci: Autis, kapasitas fungsi intelektual, kelompok interaksi sosialIntellectual Functioning in Social Interaction Subgroups of Autism ChildrenAutism classified based on social interaction and intellectual functioning. Aim of this study was to find out the association between social interaction and intellectual functioning. This hybride selective prevalence design study was conducted from January–March 2007 on autism children admitted to therapy center of Our Dream and Indigrow, Bandung. Subjects were classified based on social interaction and intellectual functioning. Age and history of behavior therapy were confounding factors. Data was analyzed using Kruskall-Wallis and two-sample Kolmogorov-Smirnov test. Subjects who fulfilled the inclusion criteria were 99 autism children. Subgroups aloof, passive, and active but odd were two, 31, 66 children, respectively. Low and high functioning were found in 70 and 29 children. Age of £5 and > 5 years were found in 58 and 41 children (pKW = 0.453). Classification of behavioral therapy were 37 and 62 children (pKS = 1.00). The association of social interaction with intellectual functioning autism showed significant value 0.04. In conclusion, this study showed association of social interaction aloof,passive, and active but odd with low and high intellectual functioning. [MKB. 2010;42(3):96-100].Key words: Autism, intellectual functioning, social interaction subgroups
Nyeri Punggung pada Operator Komputer Akibat Posisi dan Lama Duduk Sumekar, Dyah Wulan; Natalia, Deny
Majalah Kedokteran Bandung Vol 42, No 3 (2010)
Publisher : Fakultas Kedokteran, Universitas Padjadjaran

Show Abstract | Download Original | Original Source | Check in Google Scholar


Salah satu nyeri yang sering terjadi pada manusia adalah nyeri punggung, umumnya terjadi pada orang dewasa usia 33–55 tahun. Dari data Rumah Sakit Umum Daerah Lampung Tengah tahun 2006, tercatat 32 pasien nyeri otot dan meningkat dua tahun berikutnya. Sebagian besar penderita bekerja sebagai operator komputer. Tujuan utama penelitian ini untuk mengetahui pengaruh posisi dan lama duduk terhadap nyeri punggung. Jenis penelitian adalah cross sectional terhadap 120 operator komputer di Kecamatan Bandar Jaya Kabupaten Lampung. Hasil penelitian menunjukkan pada posisi duduk baik 27/65 (41,5%) mengalami nyeri punggung, sedangkan pada posisi tidak baik 11/12 (91,7%), dengan p=0,011 dan risiko 15,481 kali. Pada lama duduk >4 jam didapatkan 37/63 (58,7%) nyeri punggung, sedangkan <4 jam 1/13 (7,1%), dengan p=0,006 dan risiko 18,497 kali. Gabungan posisi dan lama duduk berpengaruh secara bermakna terhadap nyeri punggung (p=0,017 dan 0,010) dan memberikan risiko 21,400 dan 24.607 kali. Disimpulkan posisi dan lama duduk masing-masing berpengaruh dan merupakan faktor risiko terhadap nyeri punggung. Gabungan posisi dan lama duduk meningkatkan pengaruh dan risiko. [MKB. 2010;42(3):123-7].Kata kunci: Lama duduk, nyeri pungung, posisi duduk Computer Operators Low Back Pain Caused By Sitting Position and DurationOne of the pain that often occurs in human is low back pain, usually occurs in adults aged 33-55 years. According to data at regional hospital Lampung Tengah in 2006, there were 32 patients with low back pain, and increased in the next two years. Majority of patients were computer operator. The purpose of this study was to determine the effect of sitting position and duration on low back pain. This study was cross sectional study of 120 computer operators in Bandar Jaya Disctrict of Lampung. The results showed that 27/65 (41.5%) on good sitting position group experienced low back pain, while in the bad sitting position was11/12 (91.7%), with p = 0.011 and risk value 15.481 times. In> the >4 hours sitting duration group, 37/63 (58.7%) experienced low back pain, whereas in <4 hours group was 1 / 13 (7.1%), with p = 0.006 and risk value 18.497 times. Combination of -sitting position and duration has a significant effect on low back pain (p = 0.017 and 0.010) and gave 21.400 and 24 607 times risk. In conclusion, each sitting position and duration has influence on low back pain, and is a risk factor. Combination of sitting position and duration increase its impact and risk. [MKB. 2010;42(3):123-7].Key words: Low back pain, seating duration, seating position
Gambaran Foto Toraks Tuberkulosis Paru Genotipe Beijing dan Non-Beijing Soetikno, Ristaniah D.; Parwati, Ida
Majalah Kedokteran Bandung Vol 42, No 3 (2010)
Publisher : Fakultas Kedokteran, Universitas Padjadjaran

Show Abstract | Download Original | Original Source | Check in Google Scholar


Mycobacterium tuberculosis genotipe Beijing mempunyai virulensi lebih tinggi, tersebar global, dan lebih resisten dibanding non-Beijing. Penelitian analitik observasional dengan rancangan potong silang untuk mengetahui gambaran foto toraks pada kedua genotipe dilakukan periode September 2003–Desember 2005 di Rumah Sakit Hasan Sadikin Bandung. Pembacaan foto toraks oleh dua ahli radiologi. Subjek terdiri dari 206 laki-laki dan 196 perempuan, 131 genotipe Beijing dan 271 non-Beijing. Usia rata-rata 31 tahun. Hasil pembacaan oleh pengamat I pada genotipe Beijing menunjukkan gambaran ringan 60 (45,8%) dan berat 71 (54,2%); genotipe non-Beijing gambaran ringan 205 (75,6%) dan berat 66 (24,4%). Pengamat II untuk genotipe Beijing 62 (47,3%) dan 69 (52,7%);genotipe non-Beijing 208 (76,8%) dan 63 (23,2%). Diperoleh perbedaan bermakna antara genotipe Beijing dan non-Beijing (p<0,05). Kavitasi genotipe Beijing 69 (52,7%) baik pengamat I maupun II, sedangkan non-Beijing berturut-turut 61 (22,5%) dan 60 (22,1%), dengan p<0,05. Kavitas ≥4 cm pada genotipe Beijing 42 (60,0%) oleh pengamat I dan 40 (58,0%) oleh pengamat II, tidak terdapat perbedaan bermakna kavitas <4 dengan ≥4 cm (p>0,05).Kesesuaian foto toraks pengamat I dengan II untuk gambaran ringan 265 dari 270 dan berat 132 dari 137 ( >0,80). Disimpulkan gambaran foto toraks genotipe Beijing lebih berat dan lebih banyak kavitasi. [MKB. 2010;42(3):92-5].Kata kunci: tuberkulosis paru Thoracic Photo Profile of Lung Tuberculosis Beijing and Non Beijing GenotypesBeijing genotype Mycobacterium tuberculosis has higher virulence, spread globally, and more resistant compare with non Beijing. Observational analytic study with cross sectional design to determine the thoracic photos profile of the two genotypes, was done September 2003–December 2005 at Hasan Sadikin Hospital Bandung. Thoracic photos were analyzed by two radiologists. Subjects consisted of 206 men and 196 women comprising of 131 Beijing and 271 non Beijing. The mean age was 31 years. Thoracic photo description by observer I on Beijing showed 60 (45.8%) mild and 71 (54.2%) severe; non Beijing 205 (75.6%) mild and 66 (24.4%) severe. Observer II were 62 (47.3 %) mild and 69 (52.7%) severe of Beijing; 208 (76.8%) and 63 (23.2%) non Beijing, respectively. There was significant difference between Beijing and non Beijing (p <0.05). Cavitation of Beijing by both observer was 69 (52.7%), whereas non Beijing were 61 (22.5%) and 60 (22.1%), respectively (p<0.05). Cavitation of Beijing ≥4 cm was 42 (60.0%) by observer I and 40 (58.0%) by observer II, there was no significant difference between <4 and ≥4 cm (p >0.05). Similarity description from two radiologist was 265 of 270 in mild, and 132 of 137 in severe ( >0.80). In conclusion, thoracic photos of Beijing genotype is significantly more severe with more cavitation. [MKB. 2010;42(3):92-5].Key words: Beijing genotype, lung tuberculosis, non Beijing genotype, thoracic photo
Homologi Gen Seleno Metiltransferase (smt) pada Geobacillus sp. 20k dengan smt Astragalus bisulcatus Triana, Evi; Supardi, Imam; Soedigdoadi, Sunarjati; Nurhidayat, Novik
Majalah Kedokteran Bandung Vol 42, No 3 (2010)
Publisher : Fakultas Kedokteran, Universitas Padjadjaran

Show Abstract | Download Original | Original Source | Check in Google Scholar


Metil selenosistein (MSC) merupakan bentuk selenium yang paling efektif melawan sel kanker. Pembentukan MSC diperantarai oleh enzim seleno metiltransferase (disandi gen smt) sebagai mekanisme detoksifikasi selenium dengan cara metilasi selenosistein. Gen smt telahdikarakterisasi dari tumbuhan yang kaya selenium, Astragalus bisulcatus. Dilakukan penelitian eksperimental laboratorik terhadap Geobacillus sp. 20k di Lembaga Ilmu Pengetahuan Indonesia (LIPI), Cibinong, Bogor, periode November 2008–Juni 2009. Gen smt dideteksi dengan polymerase chain reaction dan sekuensing. Sekuens fragmen DNA dianalisis menggunakan program basic local alignment search tool (BLAST). Hasil pencarian homologi menunjukkan gen smt dan homolognya pada umumnya terdapat pada tumbuhan pengakumulasi selenium, antara lain A. bisulcatus, C. sinensis, dan A. thaliana dengan kesamaan >85%. Primer yang didesain untuk amplifikasi smt adalah CAAGCCACCATTCAAGGTTT dan CCCTACTGATCCCGC AATTA. Hasil amplifikasi fragmen DNA didapatkan sekitar 190 base pair. Sekuens DNA dan translasi proteinnya teridentifikasi sebagai bagian dari enzim termofilik dan smt A. bisulcatus, dengan tingkat kesamaan 83% untuk gen smt dan 88–90% untuk proteinnya. Disimpulkan Geobacillus sp. 20k memiliki gen serupa dengan gen smt A. bisulcatus sehingga pengembangan lebih lanjut sebagai sumber selenium nontoksik untuk terapi kanker perlu dipertimbangkan. [MKB. 2010;42(3):128-34].Kata kunci: kanker, selenium nontoksik, seleno metiltransferaseHomology of Seleno Methyltransferase (smt) Gene from Geobacillus sp. 20k with That from Astragalus bisulcatusMethylselenocysteine (MSC) is the most effective form of selenium against cancer. The synthesis of MSC is catalyzed by seleno methyltransferase (smt) through selenium methylation as its detoxification mechanism. Gene of smt has been characterized in selenium rich plant, Astragalus bisulcatus. This experimental laboratoric study was done on Geobacillus sp. 20k. at Lembaga Ilmu Pengetahuan Indonesia (LIPI), Cibinong, Bogor, November 2008–June 2009.Target gene was detected by polymerase chain reaction and sequencing. DNA sequence was analyzed by the basic local alignment search tool (BLAST). The results showed that smt gene and its homolog were generally found on selenium rich plants, such as A. bisulcatus, C. sinensis, and A. thaliana, with similarity more than 85%. Designed primers for amplification of smt are CAAGCCACCATTCAAGGTTT and CCCTACTGATCCCGCAATTA. Amplification of DNA fragments obtained at approximately 190 base pair. DNA sequence and its protein translation were identified as part of the thermophilic enzyme and smt of A. bisulcatus, with 83% similarity for smt genes and 88–90% for protein. In conclusion, Geobacillus sp. 20k have smt genes similar with that of A. bisulcatus, therefore further development of this isolate as a non toxic selenium source for cancer therapy could be taken into consideration. [MKB. 2010;42(3):128-34].Key words: Cancer, Geobacillus sp. 20k, non toxic selenium, methyl selenocystein, seleno methyltransferase
Perlindungan Hepatotoksisitas Ekstrak Metanol Pegagan Dibanding Vitamin E pada Tikus Model Hepatitis Vidyaniati, Putri; Ariyoga, Armaya; Satramihardja, Herri S.
Majalah Kedokteran Bandung Vol 42, No 3 (2010)
Publisher : Fakultas Kedokteran, Universitas Padjadjaran

Show Abstract | Download Original | Original Source | Check in Google Scholar


Tanaman obat pegagan (Centella asiatica Linn) sering digunakan penderita hepatitis sebagai terapi alternatif. Penelitian bertujuan untuk mengetahui efek ekstrak metanol herba pegagan pada tikus model hepatitis yang diinduksi karbon tetraklorida (CCl ) dibandingkan dengan vitamin E. Parameter yang diukur adalah kadar serum 4 glutamic pyruvic transaminase (SGPT), malondialdehid (MDA), dan luas nekrosis jaringan hati. Penelitian eksperimental laboratorik dilakukan di Laboratorium Farmakologi Rumah Sakit Hasan Sadikin Bandung, periode Oktober 2009, dengan rancangan acak lengkap terhadap 40 ekor tikus yang dibagi menjadi 8 kelompok. Kadar SGPT serum ditentukan dengan metode enzimatik, MDA diukur dengan metode Wilbur. Luas nekrosis hati dinilai dengan pewarnaan hematoksilin eosin. Hasil penelitian menunjukkan bahwa ekstrak pegagan yang diberikan prainduksi dapat mencegah kenaikan kadar SGPT dan luas nekrosis secara bermakna (p ≤0,05), tetapi tidak mencegah kenaikan kadar MDA jaringan hati secara bermakna (p >0,05). Pascainduksi, ekstrak pegagan menurunkan kadar SGPT, MDA jaringan hati, dan luas nekrosis secara bermakna (p ≤0,05). Semua efek ekstrak pegagan lebih baik daripada vitamin E, sehingga dapat bersifat hepatoprotektif. [MKB. 2010;42(3):101-7].Kata kunci: Malondialdehid jaringan hati, nekrosis, pegagan, Hepatoprotective Effect of Indian Pennywort Methanol Extract Compare with Vitamin E on Hepatitis Rats ModelHerbal medicine Indian Pennywort (Centella asiatica Linn) is commonly used as alternative therapy for hepatitisThe aim of this study was to evaluate the effect of Indian Pennywort methanol extract on carbontetrachloride (CCl )- 4 induced hepatitis rats model, compared with vitamin E. Parameters used were levels of serum glutamic pyruvic transaminase (SGPT), malondialdehide (MDA), and extent of liver necrosis. Experimental laboratory study was conducted at Pharmacology Laboratory Hasan Sadikin Hospital Bandung, October 2009, with randomized complete design on 40 rats divided into 8 subgroups. The level of SGPT was analyzed by enzymatic method, MDA level was analyzed by Wilbur method. The extent of liver necrosis was analyzed by hematoxylin eosin staining. The results, the extract, if given pre-induction of hepatotoxicity, can significantly prevent the increase of SGPT levels and the extent of necrosis (p ≤0.05), but cant significantly prevent the increase of liver tissue MDA levels (p >0.05). Postinduction,the extract can significantly reduce the SGPT levels, liver tissue MDA levels, and the extent of liver necrosis (p≤0.05). Therefore, effect of the Indian Pennywort extract is better than vitamin E, and can act ashepatoprotector. [MKB. 2010;42(3):101-7].Key words: Indian pennywort, liver tissue malondialdehide, necrosis , serum glutamic pyruvic transaminase
Tuberkulosis Perinatal Bermanifestasi sebagai Tuberkulosis Milier dan Meningitis Nataprawira, Heda Melinda D.; Faisal, Faisal
Majalah Kedokteran Bandung Vol 42, No 3 (2010)
Publisher : Fakultas Kedokteran, Universitas Padjadjaran

Show Abstract | Download Original | Original Source | Check in Google Scholar


Tuberkulosis (TB) perinatal adalah kasus TB yang jarang dilaporkan karena manifestasi klinis tidak spesifik, serta terdapat permasalahan dalam pemeriksaan laboratorium dan radiologis sehingga tidak terdiagnosis. Istilah TB perinatal menjelaskan adanya infeksi Mycobacterium tuberculosis yang terjadi pada masa perinatal baik selama kehamilan, persalinan, maupun pascapersalinan dalam masa neonatus. Seorang bayi laki-laki usia tiga bulan dirujuk ke Emergensi Anak Rumah Sakit Hasan Sadikin dengan riwayat demam lama dan tidak mau menetek. Proses kelahiran tidak ada masalah. Pada pemeriksaan fisis ditemukan letargis, febris, takipnea, dan hepatosplenomegali. Pewarnaan Ziehl Neelsen aspirat lambung menunjukkan basil tahan asam positif. Uji kulit tuberkulin menunjukkan nonreaktif, foto toraks memperlihatkan gambaran milier, dan fungsi lumbal memberikan interpretasi TB meningitis. Berdasarkan penelusuran aktif sumber penularan TB serumah, ternyata ayah dan kakek bayi merupakan sumber penularan. Selain diberikan paduan oral antituberkulosis standar, juga diberikan antibiotik dan prednison. Dalam perjalanan penyakitnya, terjadi syok sepsis serta koagulasi intravaskular diseminata dan bayi meninggal. Dari kultur darah teridentifikasi Staphylococcus haemolyticus. Disimpulkan bahwa walaupun tidak terdapat permasalahan saat kelahiran bayi, diperlukan penelusuran aktif kemungkinan TB perinatal pada keluarga dengan sumber penularan TB positif. Diperlukan kewaspadaan terdapatnya TB pada wanita hamil di negara berkembang dengan jumlah kasus TB tinggi. [MKB. 2010;42(3):135-9].Kata kunci: tuberkulosis perinatal Perinatal Tuberculosis Presenting as Miliary Tuberculosis and MeningitisPerinatal tuberculosis (TB) is rarely reported, because the clinical manifestations are not specific and there is a problem in its laboratory and radiology examination which caused undiagnosed. Perinatal TB is the preferred description that encompasses TB acquired either intra uterine, during or post delivery in early newborn period. A-3- month old baby was transferred to Pediatric Emergency Hasan Sadikin Hospital because of prolong fever and unable to breastfeed. There was no problem with delivery. Lethargic, fever, tachypnea, and hepatosphlenomegali were found on physical examination. Ziehl Neelsen smear of gastric lavage yielded positive acid fast bacilli. Tuberculine test was non reactive, chest x-ray showed a miliary pattern, and cerebral spinal fluid analysis gave tuberculous meningitis interpretation. By active finding, his father and grandfather were detected as a source of TB transmission. In additon to oral antituberculosis regimen, antibiotics and prednison were also given. Septic shock and disseminated intravascular coagulation were occurred during his illness and the baby died. Staphylococcus haemolyticus was identified from blood culture. In conclusion, although there were no problems during labor, active investigation of perinatal TB possibility is required on the family with a source of TB. Caution on TB in pregnant women is necessary at developing country with high rates of TB. [MKB. 2010;42(3):135-9].Key words: Disseminated intravascular coagulation, miliary, meningitis, perinatal tuberculosis

Page 1 of 1 | Total Record : 8