cover
Contact Name
Ofan Bosman
Contact Email
Ofan Bosman
Phone
-
Journal Mail Official
iaj.puslitbangkan@gmail.com
Editorial Address
-
Location
Kota adm. jakarta pusat,
Dki jakarta
INDONESIA
Indonesian Aquaculture Journal
ISSN : 02150883     EISSN : 25026577     DOI : -
Indonesian Aquaculture Journal is a peer-reviewed and open access journal based in Indonesia that globally/internationally accepts and publishes scientific articles in the field of aquaculture. The journal is hosted and managed by the Center for Fisheries Research, Indonesian Ministry of Marine Affairs and Fisheries and serving as a scientific platform to share research information in and contribute to the development of various disciplines of aquaculture including genetics, reproduction, nutrition and feed, fish health and diseases, engineering, and environmental assessment.
Arjuna Subject : -
Articles 10 Documents
Search results for , issue " Vol 4, No 2 (2009): (December 2009)" : 10 Documents clear
SEQUENCE ANALYSIS OF Streptococcus agalactiae, A PATHOGEN CAUSING STREPTOCOCCOSIS IN TILAPIA (Oreochromis niloticus) Lusiastuti, Angela Mariana; Taukhid, Taukhid; Kusrini, Eni; Hadie, Wartono
Indonesian Aquaculture Journal Vol 4, No 2 (2009): (December 2009)
Publisher : Pusat Penelitian dan Pengembangan Perikanan, Badan Penelitian dan Pengembangan Kelautan da

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (905.847 KB) | DOI: 10.15578/iaj.4.2.2009.87-92

Abstract

Pathogen identification based on biochemical properties can barely differentiate Streptococcus iniae and S. agalactiae. Beside that, this technique is also limited by the length of time required to complete the assays. Therefore, rapid diagnosis is necessary to initiate prompt therapeutic and prophylactic measures in order to limit any potential economic losses caused by such pathogens. The aim of the present study was to identify Streptococcosis species using amplification of S. agalactiae DNA sequence with species-specific primer Sdi 61 AGGAAACCTGCCATTTGCG and Sdi 252 CAATCTATTTCTAGATCGTGG and perform phylogenetic analysis based on DNA nucleotide sequence data. The sequencing of PCR products was performed at BPPT Puspiptek Serpong by using the respective PCR primers, Big Dye Terminator Chemistry and AmpliTaq-FS DNA polymerase. The sequencing reactions were run on the ABI Prism version 3103 – Avant Genetic Analyzer (USA) and the result was read by Sequence Navigator program (Applied Biosystem). Alignment multiple analysis was done based on the data from Genebank with BLASTN (http://blast.ncbi.nlm.nih.gov/blast.cgi) on the nucleotide level. Neighbor-joining phylogenetic trees were generated with Genetyx programme version 7 with UPGMA and MEGA software version 4.0. The result revealed that the isolates from brain, eye, and kidney of diseased Tilapia were infected by S. agalactiae and it has 99% similarity with Genebank. It has close relationship with S. agalactiae at genebank with UPGMA method. These isolates showed high variation in the first sequence which is similar to S. iniae. The information of S. agalactiae genomes suggests that gene acquisition, duplication, and reassortment have played an important role in genetic diversity and evolution of S. agalactiae. Screening of breeder fish stocks with the developed PCR methodology, followed by elimination of infected stocks, would provide an efficient strategy to control fish infected by streptococcosis.
SUSCEPTIBILITY OF CYPRINID AND NON-CYPRINID FISH CELL LINES TO KOI HERPESVIRUS (KHV) Sumiati, Tuti; Sunarto, Agus
Indonesian Aquaculture Journal Vol 4, No 2 (2009): (December 2009)
Publisher : Pusat Penelitian dan Pengembangan Perikanan, Badan Penelitian dan Pengembangan Kelautan da

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (562.776 KB) | DOI: 10.15578/iaj.4.2.2009.131-137

Abstract

Koi herpesvirus (KHV) is an emerging virus that infects koi and common carp (Cyprinus carpio) with mortality up to 95% within 7 days. The disease is rapidly spreading worldwide including to Indonesia. However, it has only been documented in koi and common carp. The aim of this research was to evaluate the susceptibility of fish cell cultures originated from cyprinid and non-cyprinid fish to KHV. Koi Fin (KF-1) and Koi Tail (KT-2) cell lines derived from koi carp and SSN-1 cells originated from fry of striped snakehead were used in this study. The cells were inoculated with tissue extract of KHV-infected koi carp (experiment 1) and virus stock of KHV (experiment 2). The cultures were incubated at 22oC and the onset and type of cytophatic effect (CPE) were observed for 21 days post inoculation. The results of experiment 1 showed that CPE was observed in KT-2 at day 6 post inoculation. In the experiment 2, however CPE was observed in KF-1 and KT-2 cells at day 4 post infection. CPE was not observed in SSN-1 of either experiment 1 or experiment 2. CPE was characterized by extensive vacuolization of the infected cells. Polymerase chain reaction (PCR) assay of cell and tissue culture supernatants confirmed that KF-1 and KT-2 showing CPE were indeed infected with KHV. The results indicated that KF-1 and KT-2 cells were susceptible and SSN-1 was resistant to KHV. The implication of these findings was also discussed in the paper.
RANDOMLY AMPLIFIED POLYMORPHIC DNA (RAPD) FINGERPRINTING OF SIX INDONESIAN POPULATIONS OF GIANT FRESHWATER PRAWN, Macrobrachium rosenbergii Imron, Imron; Sunandar, Dadan; Susilowati, Rini; Suprapto, Rommy; Khasani, Ikhsan
Indonesian Aquaculture Journal Vol 4, No 2 (2009): (December 2009)
Publisher : Pusat Penelitian dan Pengembangan Perikanan, Badan Penelitian dan Pengembangan Kelautan da

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (373.592 KB) | DOI: 10.15578/iaj.4.2.2009.93-100

Abstract

Indonesia is rich of giant fresh water prawn (GFP) germ plasms. Best utilization of these resources for the purpose of either aquaculture development or conservation of genetic resources requires some information on the structure and levels of their genetic diversity. This study was aimed to characterize those GFP genetic resources by applying RAPD genetic markers. Six Indonesian populations of GFP from Asahan, Barito, Ciasem, Ogan, GImacro and Papua were collected and analyzed for their genetic variation using five RAPD primers. The results showed the diversity within the populations, as revealed by the level of polymorphism, ranged from 29% to 76% while genetic divergence between populations as shown by genetic distance ranged from 0.04 to 0.50. In terms of genetic divergence, two genetically distinct groups of GFP, namely the Papua GFP in one group and the remaining five GFP populations in the other, were identified. The results also showed the presence of specific population markers that are useful for genetic identification of GFP populations. Implication of these finding with regard to breed development is discussed.
EFFECT OF MICROALGAE ON GROWTH AND FATTY ACID PROFILES OF HARPACTICOID COPEPOD, Tisbe holothuriae Sumiarsa, Gede Suwarthama; Imanto, Philip Teguh
Indonesian Aquaculture Journal Vol 4, No 2 (2009): (December 2009)
Publisher : Pusat Penelitian dan Pengembangan Perikanan, Badan Penelitian dan Pengembangan Kelautan da

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (116.243 KB) | DOI: 10.15578/iaj.4.2.2009.139-146

Abstract

Growth of marine copepods is influenced by feed. The purposes of this trial were to observe both growth and fatty acid compositions of harpacticoid copepod nauplii, Tisbe holothuriae by feeding with several microalgal species in laboratory: (A) Isochrysis tahiti; (B) Nannochloropsis oculata; (C) Rhodomonas sp., and (D) Tetraselmis chuii. The trial was carried out for 35 days with randomized complete design and triplicates in each treatment. The results showed that final copepod nauplii densities were not significantly different (P>0.05) in all treatments. However, lipid content of copepod nauplii fed with T. chuii was significantly higher (P<0.05) compared to that of other treatments while fatty acid profiles of EPA, DHA and DHA/EPA ratios showed both insignificant and significant differences among treatments.
PHENOTYPIC AND GENOTYPIC PERFORMANCES OF BLACK TIGER SHRIMP, Penaeus monodon HAVING FAST GROWTH TRAITS Haryanti, Haryanti; Muzaki, Ahmad; Wardana, Ida Komang; Fachrudin, Fachrudin; Sembiring, Sari Budi Moria; Permana, I Gusti Ngurah
Indonesian Aquaculture Journal Vol 4, No 2 (2009): (December 2009)
Publisher : Pusat Penelitian dan Pengembangan Perikanan, Badan Penelitian dan Pengembangan Kelautan da

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (143.932 KB) | DOI: 10.15578/iaj.4.2.2009.101-108

Abstract

Shrimp breeding research focusing on fast growth traits is important to develop better phenotypic and genotypic characters of shrimp spawners. The aim of this research was to evaluate shrimp breeding technology to produce fry having fast growth traits. Selection was initiated from the breeding of wild shrimp spawners (F-0) based on full sib mating, probiotics, biosecurity, and viral diseases diagnosis. Viral disease diagnoses were performed using 7 viruses (TSV, WSSV, IHHNV, YHV, BP, MBV, and HPV) provided in the IQ-2000 kit. The result showed that 11 families of the first generation (F-1) shrimp were phenotypically varied (big, regular and small size). Number of fry from the first generation resulted from phenotypic selection that have fast growth trait ranged between 1.99% and 4.49% of the total fry population. Genotypic performance of the shrimp broodstock (F-0) and the first generation (F-1) showed different genetic variations. Heterozigosity values were 0.2872±0.0047 (female) and 0.5487±0.0103 (male) for shrimp broodstock (F-0), 0.704±0.0261 for the first generation (F-1) having fast growth trait, and 0.6224±0.023 for F-1 having slow growth. Gene markers of fast growth trait were indicated by the genes with molecular weights of 1,025; 1,280; and 1,325 basepairs and having different DNA sequences compared to that of slow growth shrimp.
SATELLITE-MEASURED SPATIAL AND TEMPORAL CHLOROPHYLL-A VARIABILITY IN THE GULF OF TOMINI, SULAWESI Radiarta, I Nyoman
Indonesian Aquaculture Journal Vol 4, No 2 (2009): (December 2009)
Publisher : Pusat Penelitian dan Pengembangan Perikanan, Badan Penelitian dan Pengembangan Kelautan da

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (795.276 KB) | DOI: 10.15578/iaj.4.2.2009.147-152

Abstract

Chlorophyll-a concentration, an index of phytoplankton biomass, is an important parameter for fisheries resources and marine aquaculture development. Spatial and temporal variability of surface cholophyll-a (chl-a) concentration and water condition in the Gulf of Tomini were investigated using monthly climatologies the Sea-viewing Wide Field-of-view sensor (SeaWiFS), sea surface temperature (SST), and wind data from January 2000 to December 2007. The results showed seasonal variation of chla and SST in the Gulf of Tomini. High chl-a concentrations located in the eastern part of the gulf were observed during the southeast monsoon in August. During the northwest monsoon, chl-a concentrations were relatively low (<0.2 mg m-3) and distributed uniformly throughout most of the region. Chl-a concentrations peaked in August at every year, and chl-a concentrations were observed low in November at every year from 2000 to 2007. SSTs were relatively high (> 28oC) during the northwest monsoon, but low during the southeast monsoon. High wind speed was coincided with high chl-a concentrations. Local forcing such as sea surface heating and wind condition are the mechanisms that controlled the spatial and temporal variations of chlorophyll concentrations.
NON-CLOTTING HAEMOLYMPH OF WSSV-INFECTED SHRIMP: IS IT A FACTOR IN INFECTION PROCESSES? Soetrisno, Coco Kokarkin
Indonesian Aquaculture Journal Vol 4, No 2 (2009): (December 2009)
Publisher : Pusat Penelitian dan Pengembangan Perikanan, Badan Penelitian dan Pengembangan Kelautan da

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (184.132 KB) | DOI: 10.15578/iaj.4.2.2009.109-119

Abstract

White spot syndrome virus is recognized as the most prominent pathogen of penaeid shrimp and has been affecting this shrimp farming industry around the world. The virus may reduce the shrimp’s immune response and alter enzymatic and biochemical composition of tissues. Similar to other environmental stressed or other pathogeninfected shrimp, in late stages of WSSV infection, shrimp will fail to clot the haemolymph, so any minor injury will lead to increased haemolyph loss. A series of experiments to determine the effect of non-clotting haemolymph on WSSV infection were carried out in controlled facilities in Indonesia. The preliminary test showed that normal clotting time was 13.3 seconds while WSSV-injected shrimp mostly failed to clot their haemolymph 16 hours post infection (hpi). Some other clinical signs such as abnormal swimming, red discoloration, white spots and mortality were consistent with those observed by previous studies. Three shrimp species: banana shrimp (P. merguiensis) 9 g , white leg shrimp (P. vannamei) 7 g and the tiger shrimp (P. monodon) 16.5 g were water-borne-challenged with non-clotting, WSSV-infected haemolymph (NCH) from tiger shrimp donor in duplicate tanks each with 12 shrimp. The control were tiger shrimps fed with WSSV-infected tissue at the rate of 40% of bodyweight (BW) and other tiger shrimps were used as negative controls fed with commercial feed only.The study revealed that NCH dosages of 1.46%; 2.03%; and 2.06% (v/v) for eachspecies were sufficient to infect and kill all shrimps in less than two days comparedto eight days for the shrimps fed on infected tissue. The WSSV in non-clottedhaemolymph eventuallyattaches into the living tissues of healthy shrimp. This modeof infection is likely more difficult to control by the ordinary fine mesh screeningmethod.
SHORT COMMUNICATION: THE EFFECT OF TANNIN SOLUTION IN PERFORMING SUCCESFULL EGG MICROINJECTION ON AFRICAN CATFISH (Clarias gariepinus) Ath-thar, Muhammad Hunaina Fariduddin; Sumantadinata, Komar; Alimuddin, Alimuddin
Indonesian Aquaculture Journal Vol 4, No 2 (2009): (December 2009)
Publisher : Pusat Penelitian dan Pengembangan Perikanan, Badan Penelitian dan Pengembangan Kelautan da

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (119.102 KB) | DOI: 10.15578/iaj.4.2.2009.153-157

Abstract

In order to successfully perform a gene transfer activity using microinjection, an individual egg is needed. The common standard operating procedure to collect the individual egg is by applying chemical solution to remove the sticky layer covering the egg surface. Among several available solutions, tannin is one of alternative substances that can be used in performing egg microinjection on African catfish. In this study, the effect of different dosages of tannin solution to remove the sticky layer of eggs was observed. The study was conducted at the Laboratory of Fish Breeding and Genetics, Bogor Agricultural University. Prior to microinjection, the eggs were treated with different dosages of tannin solution right after fertilization. There were four different levels of dosage used as the treatments i.e.: 0.3, 0.5, 0.7, and 0.9 ppm. After the treatments, each individual egg was injected using DNA pmâactin-hrGFP plasmid with a concentration of 20 μg/mL. The results showed that the dosage of 0.5 ppm of tannin was the most effective treatment compared to the other dosages. This dosage produced 71.4% hatching rate and 57.1% transgenic embryos respectively.
PERFORMANCES OF POPULATIONS OF SEX REVERSED TILAPIA AND GENETICALLY MALE TILAPIA IN FINGERLING PONDS Ariyanto, Didik; Listiyowati, Nunuk; Himawan, Yogi
Indonesian Aquaculture Journal Vol 4, No 2 (2009): (December 2009)
Publisher : Pusat Penelitian dan Pengembangan Perikanan, Badan Penelitian dan Pengembangan Kelautan da

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (95.354 KB) | DOI: 10.15578/iaj.4.2.2009.79-86

Abstract

One of the most popular techniques in mass production of all or nearly all male tilapia population is through sex reversal. However, cross mating of YY super male with regular brood-stock is gaining popularity and has been practiced by aqua-culturists. This study was conducted to evaluate the performance of 2 populations of sex reversed tilapia (sex reversed with dietary application of 17-α methyl testosterone, SRT-1, and sex reversed with dietary administration of imidazole, SRT-2) and 1 population of genetically male tilapia (GMT) derived from YY super male until the end of fingerling rearing period. Mixed sex tilapia (MST) derived from normal mating was used as the control population. The results showed that the daily growth rates of SRT-1, SRT-2, GMT, and MST were 0.12, 0.11, 0.20, and 0.07 g/day, with survival rates were 57.83%, 64.67%, 39.67%, and 68.78%, respectively. The GMT has higher harvest yield than the other populations; SRT-1 (+15.73%), SRT-2 (+6.37%), and MST (+20.82%).
PATHOGENECITY OF GROUPER SLEEPY DISEASE IRIDOVIRUS (GSDIV: Megalocytivirus, FAMILY Iridoviridae) TO CORAL TROUT GROUPER Plectrophomus leopardus Mahardika, Ketut; Muzaki, Ahmad; Suwirya, Ketut
Indonesian Aquaculture Journal Vol 4, No 2 (2009): (December 2009)
Publisher : Pusat Penelitian dan Pengembangan Perikanan, Badan Penelitian dan Pengembangan Kelautan da

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1663.521 KB) | DOI: 10.15578/iaj.4.2.2009.121-130

Abstract

Grouper sleepy disease iridovirus (GSDIV), a member of the genus Megalocytivirus in the family Iridoviridae, has been known to cause large scale mortalities resulting in severe economic losses in grouper industries in south-east Asia including Indonesia. In this study, experimental infection of coral trout grouper Plectrophomus indicus with GSDIV was performed to evaluate the viral pathogenecity to this fish species. After virus exposure, the mortalities of coral trout grouper injected with primary and 10-1 dilution of spleen homogenates derived from tiger grouper Epinephelus fuscoguttatus were 100% and 90%, respectively. Histopathology revealed that moribund fish receiving GSDIV inoculum displayed massive formation of enlarged cells in the spleen and hematopoitic tissues. Under electron microscopy, the enlarged cells were observed as inclusion body bearing cells (IBCs) and necrotic cells allowing virus propagation within an intracytoplasmic virus assembly site (VAS). GSDIV virions were 167-200 nm in size. These findings confirmed that GSDIV has severe pathogenicity to coral trout grouper and IBCs as well as necrotic cells were determined to be the pathognomonic sign of megalocytivirus-infected coral trout grouper.

Page 1 of 1 | Total Record : 10