Setiawan Yusuf, Setiawan
Unknown Affiliation

Published : 4 Documents
Articles

Found 4 Documents
Search

Rancangan Primer Untuk Aplikasi Gen Pengkode Kitinase dari Bacillus Substillis Mardiyanto, Mardiyanto; Yusuf, Setiawan
Jurnal Penelitian Sains Vol 10, No 1 (2007)
Publisher : Faculty of Mathtmatics and Natural Sciences

Show Abstract | Original Source | Check in Google Scholar | Full PDF (4505.191 KB)

Abstract

Telah dilakukan penelitian tentang perancangan primer untuk aplifikasi gen pengkode kitinase dari Bacillus substillis. Hasil perancangan dan amplifikasi akan dipergunakan untuk proses overproduksi kitinase yang akan dimanfaatkan pada bidang kesehatan dan pertanian. Dari proses perancangan diketahui bahwa gen pengkode kitinase dari Bacillus substillus ditemudi cds tidak dimulai dari basa pertama dan ada 186 basa dihitung dari strat kodon, primer yang dihasilkan tidak memperlihatkan empat basa yang berurutan menempel pada kondisi self dimmer ataupun hair pin loop. Urutan primer yang siperoleh adalah Forward aaaagggggtgaacaaaatagagt dan Revearese acacggtcgtcgtcagcaagta
Studi Interaksi Zat Warna Tekstil Auramin dengan Asam Humat dari Tanah Gambut Lesbani, Aldes; Miksusanti, Miksusanti; Yusuf, Setiawan
Jurnal Penelitian Sains No 12 (2002)
Publisher : Faculty of Mathtmatics and Natural Sciences

Show Abstract | Original Source | Check in Google Scholar | Full PDF (5393.748 KB)

Abstract

Telah dilakukan studi interaksi zat warna auramin pada asam humat yang diekstrksi dengan kondisi alkalis dari tanah gambut. Faktor-faktor yang berpengaruh terhadap interaksi auramin  dengan asam humat dipelajari meliputi: waktu interaksi dan konsentrasi awal auramin yang kemudian dilakukan identifikasi sifat interaksi secara spektroskopi di daerah infra merah. Hasil penelitian menunjukkan bahwa dengan penetapan kinetika reaksi orde 1 didapat laju interaksi asam humat dengan auramin sebesar 4,29x102 menit-1 dengan koefisien korelasi  sebesar 0,96. Penerapan persamaan Langmuir pada konsentrasi awal auramin yang berinteraksi dengan asam humat menunjukkan kapasitas interaksi sebesar 1,725x10-2 mg/g. Hasil identifikasi secara spektroskopi dengan menggunakan spektroskopi FTIR menunjukkan bahwa secara umum spektra yang dihasilkan sebelum dan sesudah asam humat berinteraksi dengan auramin mempunyai pola spektra yang sama dengan perubahan yang terjadi yakni peningkatan intensitas dari vibrasi ulur –OH pada 3448,5 cm-1 setelah asam humat berinteraksi dengan auramin dibandingkan sebelum asam humat berinteraksi dengan auramin.
Studi Aktifitas Antioksidan Ekstrak Herba (Ocimum Sanctum L.) Oesman, Frida; Yusuf, Setiawan
Jurnal Penelitian Sains No 2 (1997)
Publisher : Faculty of Mathtmatics and Natural Sciences

Show Abstract | Original Source | Check in Google Scholar | Full PDF (323.894 KB)

Abstract

Telah dilakukan penelitian untuk menentukan aktifitas antioksidan ekstra herba kemangi (Ocimum Sanctum L.), ekstrak herba kemangi dipersiapkan dalam 3 bentuk ekstrak yaitu ekstrak n-heksa, diklorometan dan etanol, aktifitas antioksidan ditentukan dengan menggunakan metode Feri Tiosianat. Hasil penelitian menunjukkan bahwa herba kemangi mempunyai sifat antioksidan, aktifitas yang paling kuat dihasilkan oleh ekstrak n-heksan, ekstrak etanol kurang kuat dibandingkan ekstrak n-heksan, namun lebih kuat dibanding Butilhidroksianisol (BHA), sedang ekstrak diklorometana kurang kuat. 
Aktivitas Antibakteri Minyak Atsiri Temu Kunci Terhadap Terhadap Pseudomonas Aerugenose dan Aplikasinya Dalam Film Edible Pati Sagu Miksusanti, Miksusanti; Laksmi J, Betty Sri; Ponco, Bambang; Syarief, Rizal; Mulyadi, Gatot Tri; Yusuf, Setiawan
Jurnal Penelitian Sains Vol 10, No 3 (2007)
Publisher : Faculty of Mathtmatics and Natural Sciences

Show Abstract | Original Source | Check in Google Scholar | Full PDF (7086.125 KB)

Abstract

Tujuan dari penelitian ini adalah untuk menganalisa keaktifan anti bakteri dari minyak esensial Temu Kunci, penerapannya sebagai film anbakterial agent tepung sagu yang dapat dimakan (edible film). Keaktifan minyak esensial Temu Kunci dianalisa kemampuannya sebagai pembocor Pseudomonas aerugenose dan mengubah morfologinya. Fenomena membocorkan dimonitor dengan Metode Spektrometri Penyerapan Atom (ASS) dan Spektrofotometri Ultra ciolet. MBC minyak wsensial Temu Kunci adalah 0.15v/v) and 0.5(v/v). Hasil penelitian ini menunjukkan bahwa minyak esensial dapat membocorkan ion-ion anorganik Ca, Mg dan K dari bakteri dan mengubah morfologi dari bakteri tersebut. Penerapan dari minyak esensial ke film tepung Sagu sebagai antibakteria film yang dapat dimakan. Uji kualitatif keaktifan antibakteria dari film-film ditunjukkan dengan daerah inhibisi pada disk. Film menunjukkan daerah kontak yang positif dengan konsentrasi minyak lebih dari 10% (ml/g). Daerah hambatan yang ditunjukkan terjadi apabila konsentrasi minyak pada film adalah 25% (ml/g).