Articles

Found 19 Documents
Search

PENGARUH KEKERINGAN PADA TANAH BERGARAM NaCl TERHADAP PERTUMBUHAN TANAMAN NILAM

Buletin Penelitian Tanaman Rempah dan Obat Vol 21, No 1 (2010): BULETIN PENELITIAN TANAMAN REMPAH DAN OBAT
Publisher : Pusat Penelitian dan Pengembangan Perkebunan

Show Abstract | Original Source | Check in Google Scholar | Full PDF (208.852 KB)

Abstract

Untuk mengetahui pengaruh keke-ringan pada tanah bergaram NaCl terhadap pertumbuhan tanaman nilam (Pogostemon cablin Benth.) telah dila-kukan penelitian di rumah kaca Balai Pene-litian Tanaman Obat dan Aromatik (Balittro) Bogor pada Juni sampai November 2007. Faktor yang diuji adalah : 1) keadaan tanah, terdiri atas 2 taraf (keadaan lembap dan kering); dan 2) kadar garam NaCl tanah terdiri atas 3 taraf (0, 1.000, dan 2.000 ppm). Faktor-faktor yang diuji tersebut disusun dalam ran-cangan acak lengkap dengan 10 ulangan. Sedangkan parameter yang diamati meli-puti komponen tinggi tanaman, jumlah daun, jumlah buku, jumlah cabang, dia-meter batang, serta bobot basah dan kering biomas. Hasil penelitian menun-jukkan bahwa faktor keadaan dan kadar garam NaCl tanah mempengaruhi pertum-buhan tanaman nilam. Pengaruh interaksi antara kedua faktor tersebut hanya dijum-pai pada komponen diameter batang. Pada kondisi tanah kering, kadar garam NaCl 1.000 ppm atau lebih sangat nyata meng-hambat pertumbuhan diameter batang, tetapi tidak berpengaruh ketika tanah cukup lembap (basah). Kedua faktor secara individu berpengaruh nyata ter-hadap komponen pertumbuhan lainnya pada tanaman nilam. Keadaan tanah basah nyata lebih baik pengaruhnya ter-hadap perkembangan tanaman dibanding tanah  dengan  keadaan  kering.  Demikian   pula kadar garam NaCl tanah yang semakin meningkat ternyata semakin memperburuk pertumbuhan dan perkembangan tanaman nilam.

Keragaman Karakter Morfologi, Komponen Hasil, dan Hasil Plasma Nutfah Kedelai (Glycine max L.)

Bioma Vol 10 No 2 (2014): Bioma
Publisher : Biologi UNJ Press

Show Abstract | Original Source | Check in Google Scholar | Full PDF (345.057 KB)

Abstract

Abstract Soybean (Glycine max L.) is annual crop that have high morphologies and yield components diversity. The research was conducted at the first season of 2011, the objective of the research were to find morphological, yield, and yield component of Soybean germplasm (Glicine max L.). The research was carried out at experimental station BB-BIOGEN Citayam, Depok, and laboratory of Gene Bank BB-BIOGEN. The experiment used randomized block design with 100 different accessions and three replications for each accession. Based on the observation, the morphological characters have many visual forms. They are as follows: growth percentage in which 19.33 – 99%; growth types were determinate and indeterminate, the leave form was triangle to sharp; purple and white flowers; yellow and black seeds color. The range of values for each characteristic component are as follows: plant height 29,23 – 104,25 cm; number of pods per plant was 23,6 – 99,82; flowering time 33 – 47 days after planting; 100 seed weight 5,98 – 20,77 gram; maturing time 75 – 96,67 days after planting; root nodule’s weight 0,004 – 0,109 gram; seed’s weight 3,15 – 11,45 gram/plant. Among the accessions, the highest yield was shown by B 4323 (643,27 gram/3,6 m2). Significant correlation was shown between soybean’s yield components and yield which were plant’s height, growth percentage, numbers of main stem’s node, numbers of pods, seeds weight for each plant and root nodule’s weight. 100 seeds weight showed significant negative correlation with soybean components.   Key words: germplasm, morphological characteristics, soybean, yield components

Karakterisasi Sifat Toleransi terhadap Cekaman Kering Kacang Tanah (Arachis hypogega L.) Varietas Nasional pada Tahap Perkecambahan

Jurnal Matematika Sains dan Teknologi Vol 5 No 1 (2004)
Publisher : LPPM Universitas Terbuka

Show Abstract | Original Source | Check in Google Scholar | Full PDF (54.387 KB)

Abstract

The aim of this research is to determine character for drought tolerance character prediction of peanut national variety on germination phase using PEG 6000 solution. Preliminary test using drought tolerance genotipes (US 605 and US 693), susceptible genotipe (PI 409) conducted to evaluate appropriate concentration of PEG solution as drought treatment. PEG 10% is appropriate for drought treatment. Experiment using factorial random complete design with eight national varieties, Badak, Gajah, Jerapah, Kelinci, Komodo, Macan, Panther, Singa, and PEG solution. Minimum water uptake for germination is obtained from proportion between seedling weight to seed weight with seed weight. Root length, number of lateral root and seedling dry weight (without cotyledon) are counted on seventh day after germination. Seed germinated using UKDdp method. ANOVA two way for water uptake variable, ANOVA one way for root length and number of lateral root and seedling dry weight (without cotyledon) is used to analyze data, continue with DMRT and Pearson product moment correlation between minimum water uptake for germination and root length, seedling dry weight (without cotyledon). And Spearman correlation is used between minimum water uptakes for germination with number of lateral root. The results base on this research are, drought tolerance characterization of peanut national variety could evaluate on germination phase simulated by 10% PEG 6000 solution. (2) Minimum water uptake for peanut seed germination could be use as determine character to drought (3) Base on minimum water uptake for germination, Gajah and Panther grouped as drought tolerance varieties, Macan, Jerapah, Singa and Badak as medium tolerance varieties, and Komodo and kelinci as susceptible varieties.(4) In peanut, root length, number of lateral root and seedling dry weight (without cotyledon) can not be use as determine character to drought on germination phase.

Different Farmers’ Knowledge about Managing Soils Based on Educational Degree and Participation in Farmer Group Organization (A Descriptive Study on Sukatani and Wates Jaya Villages)

Biosfer: Jurnal Pendidikan Biologi Vol 7 No 2 (2014): BIOSFER: Jurnal Pendidikan Biologi
Publisher : Universitas Negeri Jakarta

Show Abstract | Original Source | Check in Google Scholar | Full PDF (164.654 KB)

Abstract

Managing soils is a beneficial effort allowing plants to grow and have dense fruit as well as to avoid them from damaging. Lack of knowledge about soil management may be related to poor soil management performance. To identify differences on farmers’ knowledge about managing soils based on their educational degree and participation in farmer group organization, thisresearch was conducted on Villages of Sukatani, Cianjur and Wates Jaya, Bogor from November to December 2012. A descriptive method with survey technique was used. Knowledge score using a multiple choice test was obtained from 89 samples selected by simple random sampling. In prerequisite testing, data was found homogenous but in abnormal distribution. Therefore, the hypothesis testing then was carried out with non-parametric tests. The average comparative rate of farmers’ knowledge based on educational degree using the Kruskal-Wallis test showed a non significant differences (p > α at 0.393 > 0.05). This occurred because farmers gained the knowledge through parental manner. Similarly, the average comparative rate of farmers’ knowledge based on their participation in farmers’ organization using the Mann-Whitney U test also showed a non-significant differences (p > α at 0.770 > 0.05). This happened because the farmers did not receive information delivered by the organization appropriately or they did not use the organization as a source of information in managing the soils. As the conclusion, educational degree and participation in organization did not cause differences to farmers’ knowledge of soil management.

SELEKSI TOLERANSI PADI RAWA TERHADAP PH RENDAH DAN PIRIT TINGGI PADA TAHAP VEGETATIF AWAL

Bioma Vol 11 No 2 (2015): Bioma
Publisher : Biologi UNJ Press

Show Abstract | Original Source | Check in Google Scholar | Full PDF (650.898 KB)

Abstract

ABSTRAK Salah satu upaya meningkatkan produktivitas padi ialah dengan memanfaatkan lahan suboptimal yang mempunyai kadar pH rendah dan pirit tinggi. Perakitan padi rawa diharapkan mampu untuk beradaptasi pada kondisi pH rendah dan pirit tinggi tersebut sehingga dapat meningkatkan produktivitas padi di Indonesia. Penelitian ini bertujuan untuk menguji respon toleransi enam galur padi rawa terhadap pH rendah (pH 3 – 4) dan pirit tinggi (300 – 400 ppm) pada tahap vegetatif awal. Penelitian ini dilakukan di Laboratorium Fisiologi FMIPA UNJ pada bulan Januari sampai Juni 2015. Metode yang digunakan dalam penelitian ini adalah eksperimen dengan menggunakan desain rancangan acak lengkap pola faktorial yang terdiri dari tiga faktor. Faktor pertama adalah pH yang tingkat keasamannya rendah (pH 3 – 4) dan tinggi (pH 5 – 6). Faktor kedua adalah pirit dengan konsentrasi rendah (100 – 200 ppm) dan tinggi (300– 400 ppm). Faktor ketiga adalah galur padi rawa yang terdiri dari Inpara 4, Inpara 5, Inpara 6, Inpara 7, Sei Lalan, dan Banyuasin. Parameter yang diukur dalam penelitian ini panjang daun, lebar daun, panjang batang, panjang akar, berat kering daun, berat kering akar, dan klorofil total. Semua parameter diamati dianalisis secara deskriptif dengan menghitung rata-rata dan standar error (±SE). Berdasarkan hasil penelitan didapatkan hasil galur yang toleran terhadap pH rendah dan pirit tinggi adalah Sei Lalan.  Kata Kunci : galur padi, pH, pirit, vegetatif awal

INDUKSI MUTASI PADA PISANG (Musa sp. - ABB) cv. KEPOK DENGAN IRADIASI GAMMA SECARA IN VITRO

Bioma Vol 12 No 1 (2016): Bioma
Publisher : Biologi UNJ Press

Show Abstract | Original Source | Check in Google Scholar | Full PDF (534.258 KB)

Abstract

Banana (Musa sp. - ABB) cv. Kepok is one of type banana processed that have a very potential commodities fruit developed to support food survival. The purpose of this study was to knowing the effect of gamma irradiation on the growth of banana plants cv. Kepok in vitro. This study was conducted in October 2014 – October 2015 in Plant Tissue Culture Laboratory, Biological – Science UNJ. The methods used was experiment with fully randomized design. Factors that tested was 6 gamma irradiation doses (0, 20, 30, 40, 50, 60 Gy) with 10 repetition. Observation of phenotypic generate diverse characters on the growth of the number of shoots and leaves. Gamma irradiation dose of 50 Gy is doses most inhibits the growth of character. Mutations that occur in banana plantlets cv. Kepok generated by the treatment doses gamma irradiation induced mutation is random.

EFEKTIVITAS MEDIA PERTUMBUHAN KHAMIR KOMERSIAL (Saccharomyces cerevisiae) UNTUK FERMENTASI BIOETANOL DARI ECENG GONDOK (Eichhornia crassipes)

Bioma Vol 12 No 2 (2016): Bioma
Publisher : Biologi UNJ Press

Show Abstract | Original Source | Check in Google Scholar | Full PDF (481.903 KB)

Abstract

This study aims to find growth medium commercial yeast (S.cerevisiae) and determine the optimum composition of bioethanol fermentation. This research was conducted at the Laboratory of Bioprocess PPPTMGB “LEMIGAS” along May to September 2015. The method used is experiment using a completely randomized design consisting of two treatment. The first treatment is an alternative growth media utilization, namely, tofu liquid waste, coconut water and a mixture of both. The second treatment is the composition of the fermentation with sugar content of 100 ml, 150 ml and 200 ml with the addition of 10 ml starter in each experiment. Data of commercial yeast cell growth (S.cerevisiae) on alternative growth media were analyzed by Anova one way. The results showed that there was an interaction of commercial yeast cell growth (S.cerevisiae) on alternative growth media. Post-hoc test showed the alternative media that consists of a mixture of tofu liquid waste and coconut water produce the highest commercial yeast cell growth at 25,8 x107 with a 7.62 log value (cells/ml). The most optimum of bioethanol produced in the fermentation process is on sugar 100 ml by the addition of 10 ml starter acquire as much as 45 ml of ethanol content.

SELEKSI SENYAWA PENGHIDROLISIS UNTUK MENGHASILKAN GULA REDUKSI DARI LIMBAH KULIT ARI KEDELAI SEBAGAI BAHAN FERMENTASI BIOETANOL

Bioma Vol 13 No 1 (2017): Bioma
Publisher : Biologi UNJ Press

Show Abstract | Original Source | Check in Google Scholar | Full PDF (657.44 KB)

Abstract

This study aims to determine the most effective compound used to hydrolyze soy husk waste to produce reducing sugar as raw material for bioethanol fermentation. The study was conducted at the Laboratory of Bioprocess PPPTMGB "LEMIGAS" in April-September 2015. The method used is experiment using a randomized block design consisting of two factors. The first factor is the type of compounds used in the process of hydrolysis, namely H2SO4, HCl, NaOH, and NH3. The second factor is the concentration of hydrolyze compound 0.2%, 0.4%. 0.6%, 0.8%, and 1% (v/v) and every treatment repeated 4 times. Parameters measured were content of reduced sugar hydrolysis product, and secondary data that content of cellulose and hemicellulose also the density of ethanol. Concentration of reducing sugar from hydrolysis of soybean husk is analyzed by two-way ANOVA test. ANOVA analysis result indicate that the best hydrolysis compounds in hydrolizing soybean husk is HCl with the optimum concentration is 0,4%. And there are interactions between treatment of compound used to hydrolyze as well as concentration on reducing sugar concentration (mg/mL) as product from soybean husk waste hydrolysis. Post-hoc test showed that HCl 0,4% produce the highest concentration of reducing sugar at 31.23 mg/mL.

FRAGMENT DNA 387BP GENE LECTIN OF SOYBEAN (Glycne Max L.) MERIIL

Bioma Vol 13 No 1 (2017): Bioma
Publisher : Biologi UNJ Press

Show Abstract | Original Source | Check in Google Scholar | Full PDF (497.512 KB)

Abstract

Lectin gene is a housekeeping gene that can be used as a molecular marker soybean (Glycine max (L.) Meriil.). This study aimed to obtain the identity of the lectin gene molecular markers for breeding purposes. This descriptive study was performed using PCR amplification and identification of sequences using a lectin gene fragment sequencing techniques and phylogenetic search using Mega Tree programme. The results obtained are lectin gene fragment along 387bp used primer Leic Foward GCGGAAACTGTTTCTTTCAGCTGG and primer Leic Reverse CCGGAAAGTGTCAAACTCAACAGCG.

PERKECAMBAHAN 4 AKSESI JEWAWUT (Setaria italica (L.) P. Beauv) PADA KONDISI CEKAMAN KEKERINGAN ARTIFISIAL

Bioma Vol 13 No 1 (2017): Bioma
Publisher : Biologi UNJ Press

Show Abstract | Original Source | Check in Google Scholar | Full PDF (510.192 KB)

Abstract

Developing of jewawut cultivation as an alternative source of carbohydrates is one of the efforts to prevent food insecurity. Drought conditions and the availability of drought-tolerant seeds became one of the problems in the development of jewawut cultivation. The purpose of these experiments were to evaluate jewawut response to drought stress simulations at germination phases and to obtain accessions tolerant to drought stress. Drought stress is performed indirectly (PEG 6000 selective media). The research was done in Laboratory of Physiology of Faculty of Mathematic and Science, UNJ from February until July 2017. The experiments were done with a completely randomized design. Parameters of germination were analyzed with Anova test and continued by Duncan Multiple Range Test (DMRT). Lethal doses of PEG reducing 50% of germination (LD50) were 23,25%, with the quadratic equation y = 1,12-2,72x. The results base on germination phase, Buru merah as drought tolerance accessions, Polman merah and Polman kuning as medium tolerance accession, and Buru kuning as susceptible accessions.