Articles

Found 4 Documents
Search

Molecular Study on The Pathogenicity of Avian Influenza Virus Wibowo, Haryadi M.; Susetya, Heru; Untari, Tri; Putri, Khrisdiana; Tabbu, Charles Rangga
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (157.738 KB)

Abstract

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.
The Development of Pathogenicity of Avian Influenza Virus Isolated from Indonesia Wibowo, Michael Haryadi; Srihanto, Agus Eko; Putri, Khrisdiana; Asmara, Widya; Tabbu, Charles Rangga
Indonesian Journal of Biotechnology Vol 18, No 2 (2013)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (202.434 KB)

Abstract

Highly pathogenic avian infl uenza outbreak in Indonesia has been reported in various poultry due toH5N1 subtype. The presence of multiple basic amino acids within the cleavage site of HA glycoprotein hasbeen identifi ed to be associated with the pathogenicity of avian infl uenza virus. The study was retrospectivestudy which was designed to characterize the cleavage site and fusion site region of haemagglutinin gene ofAIV isolated from various poultry in 2003 to 2013. Isolation, Identifi cation and propagation were carried outto collect viral stock. For virus detection, reverse transcriptase PCR (RT-PCR) method on H5 and N1 genefragment was performed. All of RT-PCR HA gene positive products were sequenced for further nucleotideanalysis and to determine the nucleotide composition at the targeted fragment. The results are all AIV isolateswere identifi ed as H5N1 subtype. The sequence analyses revealed some motives of basic amino acid motivethat were classifi ed as highly pathogenic avian infl uenza virus. Further analyses on fusion domain of all AIVisolated during the period 2003 to 2013 showed conserved amino acid.Keywords: avian infl uenza, haemagglutinin, cleavage site, basic amino acid, fusion site
The Development of Pathogenicity of Avian Influenza Virus Isolated from Indonesia Wibowo, Michael Haryadi; Srihanto, Agus Eko; Putri, Khrisdiana; Asmara, Widya; Tabbu, Charles Rangga
Indonesian Journal of Biotechnology Vol 18, No 2 (2013)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (202.434 KB) | DOI: 10.22146/ijbiotech.7876

Abstract

Highly pathogenic avian infl uenza outbreak in Indonesia has been reported in various poultry due toH5N1 subtype. The presence of multiple basic amino acids within the cleavage site of HA glycoprotein hasbeen identifi ed to be associated with the pathogenicity of avian infl uenza virus. The study was retrospectivestudy which was designed to characterize the cleavage site and fusion site region of haemagglutinin gene ofAIV isolated from various poultry in 2003 to 2013. Isolation, Identifi cation and propagation were carried outto collect viral stock. For virus detection, reverse transcriptase PCR (RT-PCR) method on H5 and N1 genefragment was performed. All of RT-PCR HA gene positive products were sequenced for further nucleotideanalysis and to determine the nucleotide composition at the targeted fragment. The results are all AIV isolateswere identifi ed as H5N1 subtype. The sequence analyses revealed some motives of basic amino acid motivethat were classifi ed as highly pathogenic avian infl uenza virus. Further analyses on fusion domain of all AIVisolated during the period 2003 to 2013 showed conserved amino acid. Keywords: avian infl uenza, haemagglutinin, cleavage site, basic amino acid, fusion site
Molecular Study on The Pathogenicity of Avian Influenza Virus Wibowo, Haryadi M.; Susetya, Heru; Untari, Tri; Putri, Khrisdiana; Tabbu, Charles Rangga
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (157.738 KB) | DOI: 10.22146/ijbiotech.7567

Abstract

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.