Tri Untari
Bagian Klinik Hewan, Fakultas Kedokteran Hewan, Universitas Udayana, Bali

Published : 22 Documents
Articles

Found 22 Documents
Search

Aktivitas Antiviral Minyak Atsiri Jahe Merah terhadap Virus Flu Burung (ANTIVIRAL ACTIVITY OF ESSENSIAL OIL RED GINGER ON AVIAN INFLUENZA) Untari, Tri; Widyarini, Sitarina; Wibowo, Michael Haryadi
Jurnal Veteriner Vol 13, No 3 (2012)
Publisher : Jurnal Veteriner

Show Abstract | Original Source | Check in Google Scholar

Abstract

The studies have reported that ginger have many activities such as antiemesis, anti-inflammatory,anti-bacterial and anti-parasites. Therefore, this study was conducted to evaluate antiviral effect of essentialred ginger oil againts Avian Influenza (AI) in ovo using hemagglutination test (HA). Avian Influenzaviruses were treated with 0,01%, 0,1% and 1% of essential red ginger oil, and then inoculated in chickenembryonated egg via allantoic sac. Allantoic fluid was harvested using for HA test . Result of this studyshows that application of 1% of essential red ginger oil results in the reduction of titer HA . Interestingly,essential oil shows antiviral activity revealed HA titre 20 whereas the titre HA AI which AI virus treatedwith 0,01% and 0,1% essential red ginger oil, the HA titer was 25. The conclution of this study proved thatessensial oil 1% of the red gingger is the best concentration as antiviral activity .
Isolasi, Identifikasi, Sifat Fisik, dan Biologi Virus Tetelo yang Diisolasi dari Kasus di Lapangan (ISOLATION, IDENTIFICATION, PHISICAL, AND BIOLOGICAL CHARACTER OF NEWCASTLE DISEASE VIRUS ISOLATED FROM FIELD CASES) Wibowo, Michael Haryadi; Untari, Tri; Wahyuni, Anastasia Endang Tri Hastuti
Jurnal Veteriner Vol 13, No 4 (2012)
Publisher : Jurnal Veteriner

Show Abstract | Original Source | Check in Google Scholar

Abstract

native chicken farm suspected to Newcastle disease (ND) virus infection. Specimens were taken andcollected from the lung was further processed. Suspected materials were inoculated into allantoic sacc inspecific pathogenic free of 10 days embryonating egg chicken. The growth of the virus was determined withthe ability to agglutinate the chicken red blood cells or hemaglutination test. Positive hemaglutinationwas performed with hemaglutinatin inhibition test using specific antibody against ND virus. Method forND virus isolation, propagation and identification were based on the standard procedure of serologicalidentification for ND virus serological identification. 13 out of 34 samples were identified as ND viruses.Observation on the course and time of the virus to kill the chicken embryo could be differentiated intomoderate virus patho-type were 10 isolates and a virulent strains were 3 isolates. Further characterizationbased on the elution time observation indicated 11 isolates were not pathogenic strain and 2 isolates werenot virulent strain. Hemagglutinin stability study revealed that 11 isolates were sensitive being heated at560C for 30 minutes while 2 isolates were resistant. Biological characteristic of ND virus to hemagglutinateon various mammalian red blood cells indicating that most isolates were HA negative. Two isolates wereHA positive with cattle, horse and sheep red blood cell, and one isolate indicated positive HA test by usingsheep red blood cell. Control virus was lentogenic patho-type of La Sota strain showed HA and HI testpositive, elution time was 29 minutes, stability on the hemagglutinin after heating was 2 minutes and HApositive with cattle, horse and sheep red blood cell.
Isolasi dan Identifikasi Bakteri dari Ayam Broiler yang menunjukkan Gejala Penyakit Respirasi Untari, Tri
Jurnal Sain Veteriner Vol 21, No 1 (2003)
Publisher : Fakultas Kedokteran Hewan

Show Abstract | Original Source | Check in Google Scholar | Full PDF (728.814 KB)

Abstract

.
Isolasi Dan Identifikasi Staphylococcus aureus Pada Susu Anjing Di Wilayah Yogyakarta Mulyani, Guntari Titik; Hapsari, Andriani Dwi; Indarjulianto, Soedarmanto; Untari, Tri; ., Yanuartono; Raharjo, Slamet; Purnamaningsih, Hary
Jurnal Sain Veteriner Vol 26, No 1 (2008)
Publisher : Fakultas Kedokteran Hewan

Show Abstract | Original Source | Check in Google Scholar

Abstract

.
KORELASI UJI HAMBATAN HEMAGLUTINASI DAN ENZYME LINKED IMMUNOSORBENT ASSAY UNTUK EVALUASI TITER ANTIBODI SETELAH VAKSINASI DENGAN VIRUS INFECTIOUS BRONCHITIS PADA AYAM Untari, Tri
Jurnal Sain Veteriner Vol 22, No 1 (2004)
Publisher : Fakultas Kedokteran Hewan

Show Abstract | Original Source | Check in Google Scholar | Full PDF (1087.768 KB)

Abstract

.
Studi Lesi Makroskopis dan Mikroskopis Embrio Ayam yang Diinfeksi Virus Newcastle Disease Isolat Lapang yang Virulen Putra, Hamdu Hamjaya; Wibowo, Haryadi; Untari, Tri; Kurniasih, Kurniasih
Jurnal Sain Veteriner Vol 30, No 1 (2012)
Publisher : Fakultas Kedokteran Hewan

Show Abstract | Original Source | Check in Google Scholar | Full PDF (7586.928 KB)

Abstract

Newcastle disease (ND) disebabkan oleh Avian paramyxovirus dari keluarga Paramyxoviridae, merupakan salah satu penyakit utama pada ayam. Penelitian ini bertujuan untuk mengetahui lesi pada organembrio ayam secara makroskopis maupun mikroskopis yang diinfeksi oleh virus ND. Telur ayam berembrio (TAB) diinokulasi oleh virus ND Salatiga dan virus ND La Sota. Aquabidestilata digunakan sebagai kontrolnegatif. TAB yang menunjukkan kematian embrio disimpan di refrigerator, kemudian dikoleksi cairan allantoisnya. Embrio ayam yang mati dilakukan pengamatan secara makroskopis. Organ dari embrio ayam dibuat preparat histopatologi dengan pewarnaan Hematoxylin dan Eosin (H&E) untuk pemeriksaan mikroskopis. Identifikasi adanya pertumbuhan virus ND pada isolat dilakukan dengan uji hemaglutinasi dan uji hemaglutinasi inhibisi menggunakan serum anti ND. Embrio ayam yang diinfeksi oleh virus ND Salatiga mengalami kematian kurang lebih 26 jam pasca inokulasi. Lesi makroskopis yang teramati berupa hemoragipada kulit. Lesi mikroskopis menunjukkan adanya kongesti dan hemoragi pada paru-paru, kongesti dan radang pada kulit, serta kongesti pada usus, hati, ginjal, dan jantung. Embrio ayam yang diinfeksi virus ND La Sota secara makroskopis teramati kongesti ringan pada kulit. Lesi mikroskopisnya menunjukkan adanya kongesti pada paru-paru, kongesti dan radang pada kulit, serta kongesti pada hati, ginjal, dan jantung. Lesi makroskopis dan mikroskopis embrio ayam yang diinfeksi virus ND Salatiga lebih parah bila dibandingkan dengan lesi akibat virus ND La Sota.Kata kunci: Newcastle disease, embrio ayam, lesi makroskopis, lesi mikroskopis, La Sota
The use of earthworm meal (Lumbricus rubellus) as anti-pullorum agent in feed additive of broiler chicken Damayanti, Ema; Sofyan, Ahmad; Julendra, Hardi; Untari, Tri
Indonesian Journal of Animal and Veterinary Sciences Vol 14, No 2 (2009)
Publisher : Indonesian Animal Sciences Society

Show Abstract | Original Source | Check in Google Scholar | Full PDF (114.826 KB)

Abstract

The aim of this research was to study the use of earthworm meal (TCT) L. rubellus as anti pullorum agent in poultry feed additive (IP). The antibacterial activity of TCT against Salmonella pullorum was examined using diffusion agar method at each of the following concentrations: 0, 25, 50, 75 and 100% (w/v) in 100 µL DMSO. In vivo test was conducted using 80 broiler chicken and were infected by S. pullorum with treatments of: IP0: IP contained 0% TCT, IP1: IP contained 25% TCT, IP2: IP contained 50% TCT, IP3: IP contained 75% TCT and IP4: IP contained 100% TCT. Each treatment was replicated 4 times with 4 chicks each. Feed additive was periodically fed to broiler during 7 days before and 10 days after infection. Anti-pullorum activities were evaluated using serology test, isolation and biochemical identification of S. pullorum. The results showed that 75% TCT was optimum to inhibit S. pullorum in vitro. The isolation and identification of S. pullorum results showed that 0 out of 8 (0%) broilers treated with IP4 was not infected by S. pullorum whereas 1 out of 2 (50%) broilers treated with IP0 were infected by S. pullorum. The reduction of S. pullorum prevalence as followed by increasing TCT in feed additive. In conclusion, TCT as poultry feed additive could inhibit S. pullorum infection. Key words: Earthworm Meal, Feed Additive, S. Pullorum
The use of earthworm meal (Lumbricus rubellus) as anti-pullorum agent in feed additive of broiler chicken Damayanti, Ema; Sofyan, Ahmad; Julendra, Hardi; Untari, Tri
Jurnal Ilmu Ternak dan Veteriner Vol 14, No 2 (2009): JUNE 2009
Publisher : Indonesian Center for Animal Research and Development (ICARD)

Show Abstract | Original Source | Check in Google Scholar | Full PDF (114.826 KB)

Abstract

The aim of this research was to study the use of earthworm meal (TCT) L. rubellus as anti pullorum agent in poultry feed additive (IP). The antibacterial activity of TCT against Salmonella pullorum was examined using diffusion agar method at each of the following concentrations: 0, 25, 50, 75 and 100% (w/v) in 100 µL DMSO. In vivo test was conducted using 80 broiler chicken and were infected by S. pullorum with treatments of: IP0: IP contained 0% TCT, IP1: IP contained 25% TCT, IP2: IP contained 50% TCT, IP3: IP contained 75% TCT and IP4: IP contained 100% TCT. Each treatment was replicated 4 times with 4 chicks each. Feed additive was periodically fed to broiler during 7 days before and 10 days after infection. Anti-pullorum activities were evaluated using serology test, isolation and biochemical identification of S. pullorum. The results showed that 75% TCT was optimum to inhibit S. pullorum in vitro. The isolation and identification of S. pullorum results showed that 0 out of 8 (0%) broilers treated with IP4 was not infected by S. pullorum whereas 1 out of 2 (50%) broilers treated with IP0 were infected by S. pullorum. The reduction of S. pullorum prevalence as followed by increasing TCT in feed additive. In conclusion, TCT as poultry feed additive could inhibit S. pullorum infection. Key words: Earthworm Meal, Feed Additive, S. Pullorum
Deteksi Bovine Herpesvirus-1 Secara Immunohistokimia pada Membran Korioallantois Telur Ayam Berembrio (IMMUNOHISTOCHEMISTRY DETECTION OF BOVINE HERPESVIRUS-1 IN CORIOALLANTOIC MEMBRANE OF CHICKEN EMBRYONATED EGG) Kristianingrum, Yuli Purwandari; Tabbu, Charles Rangga; Sutrisno, Bambang; Widyarini, Sitarina; ., Kurniasih; Untari, Tri; Kusumawati, Asmarani
Jurnal Veteriner Vol 16, No 4 (2015)
Publisher : Jurnal Veteriner

Show Abstract | Original Source | Check in Google Scholar

Abstract

Infectious Bovine Rhinotracheitis (IBR) is caused by Bovine Herpes virus-1 in the cattle. The clinicalsigns demonstrate depression, anorexia, swelling of the vulva, redness of the vestibule, pustule and ulceron the vaginal mucosal. Based on previous research, IBR virus from the nasal swab could be grown inchorio-allantoic membrane of embryonated chicken eggs. This study aim was to confirm whether IBR virusin cattle could be grown in embryonated chicken eggs as a substitute for cell culture. A total of five nasalswab samples from the cows that were positive for IBR infection (diagnosed by Polymerase Chain Reactionand cell culture) were inoculated on the chorio-allantois membrane of embryonated chicken eggs.Observation of lesions performed at 3-5 days after inoculation. Re-inoculation (passage) was done threetimes. Pock characteristic lesions were observed on the corioallantoic membrane with the size of 5-7 mm,rounded shape, opaque edge, with necrosis in the central area. Furthermore, pock lesions were processedfor hematoxylin and eosin staining and immuno-histochemistry. The result of hematoxylin and eosinstaining showed that the formation of intranuclear inclusion bodies and vacuolization of the epithelial cellof membrane was observed. Immuno-histochemistry staining showed positive reaction for antibodiesagainst BHV-1 in the epithelial cells membrane. In conclusion, embryonated chicken eggs could be usedas a medium for detection of IBR.
Molecular Study on The Pathogenicity of Avian Influenza Virus Wibowo, Haryadi M.; Susetya, Heru; Untari, Tri; Putri, Khrisdiana; Tabbu, Charles Rangga
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Original Source | Check in Google Scholar

Abstract

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.