Charles Rangga Tabbu
Bagian Patologi Fakultas Kedokteran Hewan UGM Yogyakarta

Published : 23 Documents

Found 23 Documents

Isolasi dan Identifiicasi Serologis Virus Avian Influenza Dari Sampel Unggas Yang Diperoleh di D.I. Yogyakarta dan Jawa Tengah = Isolation and Serological Identification of Avian Influenza Virus From Poultry Sample ... Wibowo, Michael Haryadi; Asmara, Widya; Tabbu, Charles Rangga
Jurnal Sain Veteriner Vol 24, No 1 (2006)
Publisher : Fakultas Kedokteran Hewan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3152.733 KB)


Avian Influenza (AI) merupakan penyakit penting pada unggas, karena dapat menyebabkan kerugian ekonomi secara signifikan, dengan tingkat morbiditas dan mortalitas penyakit sangat tinggi. L,ebih dan itu potensi penularan penyakit AI dari hewan ke manusia, memberikan dampak ekonomi tersendiri. Beberapa kasus yang diduga sebagai AI banyak mewabah di beberapa daerah di Indonesia. Penyakit tersebut cukup membingungkan peternak dan sangat dikacaukan dengan penyakit Newcastle (ND) karena kedua penyakit mempunyai kemiripan karakter dan gejala klinis. Penelitian ini bertujuan untuk mengkonfirmasi apakah wabah penyakit tersebut disebabkan oleh virus AI atau virus ND. Sampel isolasi diambil dari paru atau trakhea, kemudian diproses lebih lanjut untuk diisolasi, dipropagasi secara in ovo menggunakan telur ayam berembrio umur 9 sampai 12 hari, spesific pathogen free atau telur yang setidaknya bebas antibodi terhadap virus AI. Teknik isolasi menurut standar prosedur Office International des Epizooties (01E) dan kemungkinan adanya pertumbuhan virus diuji terhadap kemampuan mengaglutinasi sel darah merah ayam atau hemaglutinasi (HA). Uji HA positif, mengindikasikan ada pertumbuhan virus ND atau virus AL Kedua jenis virus tersebut dapat dibedakan dengan uji hemaglutinasi inhibisi (HI) menggunakan serum anti dari masing-masing virus yang diuji. Berdasarkan hasil penelitian ini dapat diambil suatu kesimpulan bahwa beberapa sampel unggas, yaitu: ayam petelur, ayam broiler, ayam kampung, dan burung puyuh, yang di peroleh dari beberapa daerah di D.I. Yogyakarta dan Jawa Tengah dan secara klinis menunjukkan gejala tersifat maupun tidak tersifat AI, secara serologis dapat dikonfirmasi sebagai virus avian influenza sub-tipe 145Ni.
Tapak Perlekatan Reseptor Virus Flu Burung yang Diisolasi dari Berbagai Unggas Sejak tahun 2003 sampai 2008 (RECEPTOR BINDING SITE OF AVIAN INFLUENZA VIRUS H5N1 ISOLATED FROM VARIOUS POULTRIES SINCE 2003 TO 2008) Wibowo, Michael Haryadi; Tabbu, Charles Rangga; Asmara, Widya; Susetya, Heru
Jurnal Veteriner Vol 13, No 2 (2012)
Publisher : Jurnal Veteriner

Show Abstract | Download Original | Original Source | Check in Google Scholar


Avian Influenza (AI) is an infectious disease in poultry, caused by type A of avian influenza virus(AIV), in the family of Orthomyxoviridae. Almost all birds’ species are sensitive to the AI. Beside theability to infect various species of poultry. AIV type A has a wide range of host including all bird species,mammals, dan human. Today some scientists reported that the cases of AI in mammals, including humansare increasing. This condition suggests that the AI virus circulated in the field may have some mutationsin the amino acid determinants responsible receptor binding site (RBS). A research was therefore designedto investigate the molecular level of HA gen fragment responsible for receptor binding site of AIV isolatedfrom various poultry since 2003 to 2008. Molecular characterization was based on the amplification ofreceptor binding site of HA gene by reverse transcriptase polymerase chain reaction (RT-PCR). All RTPCRof HA gene positive products were sequenced to determine the nucleotide composition at the targetedfragment. Sequences yielded were analyzed by program Mega 4.0 versions, including multiple alignment,deductive amino acid prediction, and establishment of phylogenetic tree. The results show that all AIVisolates could be determined of some conserved amino acids residues responsible for RBS which indicatethe binding preference of avian like receptor, sialic acid ? 2, 3 galactose except isolate A/Layer/Jabar/MHW-RBS-02/2008 which could be found a deletion of amino acid at position of 129 dan mutation of 151isoleucine into threonine. Phylogenetic study showed that clustering of AIV did not base on species of birdor geographic origin of AI viruses which were studied.
Identifikasi Subtipe Hemaglutinin Virus Avian Influenza Pada Berbagai Spesies Unggas dengan RT-PCR Asmara, Widya; Wibowo, M. Haryadi; Tabbu, Charles Rangga
Jurnal Sain Veteriner Vol 23, No 1 (2005)
Publisher : Fakultas Kedokteran Hewan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1809.212 KB)


Wabah avian influenza yang high pathogenic telah terjadi di beberapa wilayah di Indonesia. Infeksi virus ini menimbulkan penyakit respirasi dengan mortalitas yang tinggi pada berbagai spesies unggas, termasuk itik, ayam dan puyuh. Isolasi virus Al dari sampel itik, ayam kampung, petelur dan pedaging telah berhasil dilakukan di Laboratorium Mikrobiologi Fakultas Kedokteran Hew an Universitas Gadjah Mada, menggunakan telur ayam berembrio. Subtipe hemaglutinin virus diidentifikasi dengan RT-PCR menggunakan primer spesifik H5 dan H7. Hasil penelitian memberi indikasi bahwa virus AI yang terisolasi tersebut termasuk dalam subtipe H5.
Kajian Kasus-kontrol Avian Influenza Pada Unggas di Jawa Timur, Jawa Tengah dan Daerah Istimewa Yogyakarta= A Case-control Study on Avian Influenza in Poultry in East Java, Central Java and Yogyakarta Special Province. Widiasih, Dyah Ayu; Susetyo, Heru; Sumiarto, Bambang; Tabbu, Charles Rangga; Budiharta, Setyawan
Jurnal Sain Veteriner Vol 24, No 1 (2006)
Publisher : Fakultas Kedokteran Hewan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1791.726 KB)


Kajian kasus-kontrol yang dirancang untuk menyidik kejadian avian influenza (Al) dan mencari hubungannya dengan faktor resiko penyakit, telah dilakukan terhadap 218 dusun di Jawa Timur, Jawa Tengah dan Daerah Istimewa Yogyakarta. Sebagai kasus (109 dusun) adalah dusun yang pernah dilaporkan atau sedang mengalami kasus AI, dan kontrol (109 dusun), adalah dusun yang dilaporkan belum pernah mengalami, tetapi dekat dengan dusun kasus. Kuesioner digunakan untuk menjaring variabel yang diperkirakan berasosiasi dengan kejadian AI. Data yang diperoleh dianalisis dengan Chi Square (x2) dan odds ratio (OR). Hasil kajian menunjukkan bahwa faktor adanya hewan pengerat (OR = 1,90), faktor adanya burung liar (OR = 24,00), faktor pekerja pulang sehabis kerja (OR = 2,65), dan faktor sektor III (OR = 1,79) mempunyai asosiasi karat dengan kejadian AI di suatu dusun, sedangkan beberapa faktor biosekuriti berasosiasi lemah (OR = 1,0 – 1,5) terhadap kejadian Al.
The Development of Pathogenicity of Avian Influenza Virus Isolated from Indonesia Wibowo, Michael Haryadi; Srihanto, Agus Eko; Putri, Khrisdiana; Asmara, Widya; Tabbu, Charles Rangga
Indonesian Journal of Biotechnology Vol 18, No 2 (2013)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (202.434 KB) | DOI: 10.22146/ijbiotech.7876


Highly pathogenic avian infl uenza outbreak in Indonesia has been reported in various poultry due toH5N1 subtype. The presence of multiple basic amino acids within the cleavage site of HA glycoprotein hasbeen identifi ed to be associated with the pathogenicity of avian infl uenza virus. The study was retrospectivestudy which was designed to characterize the cleavage site and fusion site region of haemagglutinin gene ofAIV isolated from various poultry in 2003 to 2013. Isolation, Identifi cation and propagation were carried outto collect viral stock. For virus detection, reverse transcriptase PCR (RT-PCR) method on H5 and N1 genefragment was performed. All of RT-PCR HA gene positive products were sequenced for further nucleotideanalysis and to determine the nucleotide composition at the targeted fragment. The results are all AIV isolateswere identifi ed as H5N1 subtype. The sequence analyses revealed some motives of basic amino acid motivethat were classifi ed as highly pathogenic avian infl uenza virus. Further analyses on fusion domain of all AIVisolated during the period 2003 to 2013 showed conserved amino acid. Keywords: avian infl uenza, haemagglutinin, cleavage site, basic amino acid, fusion site
Deteksi Bovine Herpesvirus-1 Secara Immunohistokimia pada Membran Korioallantois Telur Ayam Berembrio (IMMUNOHISTOCHEMISTRY DETECTION OF BOVINE HERPESVIRUS-1 IN CORIOALLANTOIC MEMBRANE OF CHICKEN EMBRYONATED EGG) Kristianingrum, Yuli Purwandari; Tabbu, Charles Rangga; Sutrisno, Bambang; Widyarini, Sitarina; ., Kurniasih; Untari, Tri; Kusumawati, Asmarani
Jurnal Veteriner Vol 16, No 4 (2015)
Publisher : Jurnal Veteriner

Show Abstract | Download Original | Original Source | Check in Google Scholar


Infectious Bovine Rhinotracheitis (IBR) is caused by Bovine Herpes virus-1 in the cattle. The clinicalsigns demonstrate depression, anorexia, swelling of the vulva, redness of the vestibule, pustule and ulceron the vaginal mucosal. Based on previous research, IBR virus from the nasal swab could be grown inchorio-allantoic membrane of embryonated chicken eggs. This study aim was to confirm whether IBR virusin cattle could be grown in embryonated chicken eggs as a substitute for cell culture. A total of five nasalswab samples from the cows that were positive for IBR infection (diagnosed by Polymerase Chain Reactionand cell culture) were inoculated on the chorio-allantois membrane of embryonated chicken eggs.Observation of lesions performed at 3-5 days after inoculation. Re-inoculation (passage) was done threetimes. Pock characteristic lesions were observed on the corioallantoic membrane with the size of 5-7 mm,rounded shape, opaque edge, with necrosis in the central area. Furthermore, pock lesions were processedfor hematoxylin and eosin staining and immuno-histochemistry. The result of hematoxylin and eosinstaining showed that the formation of intranuclear inclusion bodies and vacuolization of the epithelial cellof membrane was observed. Immuno-histochemistry staining showed positive reaction for antibodiesagainst BHV-1 in the epithelial cells membrane. In conclusion, embryonated chicken eggs could be usedas a medium for detection of IBR.
Akumulasi Timah Hitam dalam Daging dan Tulang Ayam Kampung dan Ayam Negeri (LEAD ACCUMULATION IN MEAT AND BONES OF DOMESTIC AND BROILER CHICKEN) ., Djohan; Tabbu, Charles Rangga
Jurnal Veteriner Vol 16, No 4 (2015)
Publisher : Jurnal Veteriner

Show Abstract | Download Original | Original Source | Check in Google Scholar


Lead is a heavy metal polluting the environment, and its accumulation in animal or human bodies canhave neurotoxic and nephrotoxic effects on animals and human. Lead-contaminated chicken meat can bethe source of lead to human. Lead exposure to human can be assessed by measuring its concentration andaccumulation in chicken body parts and analyzing chicken consumption patterns. This study was conductedto measure lead concentrations in chicken body parts and to estimate lead exposure caused by consumptionof chicken body parts (breast, legs, wings) and tissues (meat, skin, cartilage, spongy bones). Samples wereextracted by using aqua regia digestible method with a mixture of HCl: HNO3 (3:1; v/v) and leadconcentrations were measured by the Atomic Absorption Spectrophotometry (AAS) method. The leadconcentrations in chicken tissues varied from< 0.01 to 1.81?g.g-1dry weight.The average concentrations oflead in chicken tissues were lower than the recommended safety level of lead in chicken meat (1.0?g.g-1),except for the breast cartilage (1.03?g.g-1). The lowet accumulation level 2.6 ?g g-1 was found in domesticchicken wings while the highest of 32.9 ?g g-1 was found in broiler chicken breast (total of meat, skin,cartilage). Based on the data of lead accumulation in chicken tissues, a polynomial equation describing theprobability (P) to be exposed to certain amount of lead in chicken tissues (A, in ?g) was determined as P =-(1 x 10-3)A2 + (6,4 x 10-2)A.
Jurnal Sain Veteriner Vol 16, No 1 (1998)
Publisher : Fakultas Kedokteran Hewan

Show Abstract | Download Original | Original Source | Check in Google Scholar


This experiment was designed to study the effects of active Gumboro vaccine of high pathogenicity on the morphology of bursa Fabricius and the immune response of broiler to vaccination against Newcastle disease (ND). This experiment was conducted in 330 broilers, which were vaccinated with aviive Gumboro vaccine of high, intermediate and low pathogenicity (control) at the age of 12 days. Experimental chickens were also vaccinated against ND at the age of 4 and 18 days. Diameter of bursas were measured at day 1st through 7th, 14th, 21th, 28th, 35th post Gumboro vaccination. Evaluation of hemaggutination inhibition (HI) liters against ND virus (NDV) were done only at day 7th, 14th, 2lth, 28th and 35th. Samples of bursa were stained with the method of hematoxylin and eosin (H & E). Pathologic evaluation revealed lesions in the bursa Fabricius of chickens vaccinated with Gumboro vaccine of high pathogenicity as well as changes in the diameter of bursa of lesions in this organ. The HI titers against NDV were lower in the group of chickens vaccinated with Gumboro vaccine of high pathogenicity compared with them of other groups. Results indicated that active Gumboro vaccine of high pathogenicity caused lesions in the bursa,which were similar to lesions caused by exposure to field Gumboro virus.
Jurnal Sain Veteriner Vol 15, No 1&2 (1996)
Publisher : Fakultas Kedokteran Hewan

Show Abstract | Download Original | Original Source | Check in Google Scholar


This field evaluation was conducted to study the level of protection, post vaccinal reactions and zootechninal performance of groups of chickens which have been vaccinated with Newcastle disease (ND) vaccine of VG/GA strain.This evaluation was done in 26.000 broilers from 4 farms, which have different condition in management practices and were located in different areas of Java.Chickens were vaccinated with VGAGA vaccine or with B-l/La Sota vaccine with/without inactivated ND. Serological tests were done at the age of 28 and 35 days, whereas challenge test with local ND virus isolates was done at the age of 45 days. Results of field evaluation indicated that in broilers, the VG/GA vaccine induced a high level of protection agamst the challenge test with a local (Indonesia) ND virus isolate and against infection with field ND virus. Statistical analysis indicated that the hemagglutination inhibition (HI) titers against NDV were significantly higher (P < 0,05) in group of chickens vaccinated with VG/GA with/without inactivated ND compared to group of chickens vaccinated with B-l/La Sota with/without inactivated ND vaccine. In certain conditions, the post vaccinal reactions were milder and the zootechnkal performance was better in groups of chickens vaccinated with VG/GA strain compared to groups vaccinated with B-l/La Sota.
Molecular Study on The Pathogenicity of Avian Influenza Virus Wibowo, Haryadi M.; Susetya, Heru; Untari, Tri; Putri, Khrisdiana; Tabbu, Charles Rangga
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (157.738 KB)


Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.