Articles

Found 12 Documents
Search

PF-3 PREVALENCE AND RISK FACTORS OF JEMBRANA DISEASE, BENGKALIS DISTRICT RIAU PROVINCE Mardani, Hani Muhamad; Anggreini, Dewi; Miswati, Yuli; Susetya, Heru
Hemera Zoa Proceedings of the 20th FAVA & the 15th KIVNAS PDHI 2018
Publisher : Hemera Zoa

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (465.783 KB)

Abstract

Jembrana disease (JD) is contagious viral disesase in Bali cattle, caused by Retrovirus from member of Lentivirus group called by Jembrana disease virus (JDV). Jembrana disease outbreak in Bengkalis district first occured 2013 and until now is endemic. This purpose of study is to determine the prevalence of JD and to identify a risk factor associated with JD in Bengkalis district.
DIAGNOSIS AND MOLECULAR MARKER ANALYSIS OF BALI’S RABIES VIRUS ISOLATES (DIAGNOSIS DAN ANALISIS PENANDA MOLEKULER VIRUS RABIES ISOLAT BALI) Dibia, I Nyoman; Sumiarto, Bambang; Susetya, Heru; Putra, Anak Agung Gde; Mahardika, I Gusti Ngurah Kade; Scott-Orr, Helen
Jurnal Veteriner Vol 15 No 3 (2014)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

The direct fluorescent antibody test (dFAT) was recommended by both World Health Organization(WHO) and Office International des Epizooties (OIE) as a standard diagnostic technique for rabies. Sincethe outbreak of rabies in Bali, it was ascertain the importance to develop a reverse transcriptase-polymerasechain reaction (RT-PCR) technique with specific primers as an alternative diagnostic method. The aim ofthis study was to develop a RT-PCR technique for rabies diagnosis in animals and find out the molecularmarker of Bali?s rabies virus (BRV) isolates based on the sequence of nucleoprotein (N) gene. Brainsamples were obtained during 2009 from 14 suspected rabid dogs and one cattle, where rabies viruseswere isolated. The dFAT was used to detect the presence of rabies viral antigen. Ribonucleic acid (RNA) ofrabies viruses was extracted with TRIzol reagent. Fragment of N gene was amplified using one-step RTPCRmethod with specifically-designed primer pairs and sequenced using ABI automatic sequencer. Multiplealignment of nucleotide and deduced amino acid sequences were analyzed using ClustalW of MEGA 4.0program. This study found that twelve out of fifteen animal brain samples confirmed as rabies by dFAT.Similarly, a single band of 1215 bp PCR product for rabies virus was also detected in twelve out of twelve(100%) dFAT rabies positive samples. It is therefore evident that alternative diagnostic of rabies inanimals can be established using RT-PCR technique. The results showed that the RT-PCR has a very highagreement with dFAT. Polymorphic sites of N gene of twelve BRV isolates were identified at the position186, 501, 801, 840, 1068 and 1153. Bali?s rabies virus isolates have conserved amino acid (isoleucine)alterations at position 308 (open reading frame). Isoleucine distinguished between all Bali?s isolates andthe all of isolates from other area of Indonesia and other part of the world. This finding significantlydifferent as compared to other rabies virus isolates from other part of Indonesia or the world documentedon the GenBank. Accordingly it is proposed that it can be used as molecular marker and believed to be thefirst study of molecular marker of rabies virus in Indonesia.
PENILAIAN RISIKO KUALITATIF MASUK DAN TERSEBARNYA RABIES PADA ANJING KE KOTA SORONG PROVINSI PAPUA BARAT Kurniawan, Muchammad Taufik; Susetya, Heru; Sumiarto, Bambang
Jurnal Sain Veteriner Vol 36, No 2 (2018): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (13116.929 KB) | DOI: 10.22146/jsv.39538

Abstract

The rabies outbreaks of Indonesia in these two decades tends to spread faster to other islands/regions. Trade trafficking and people's habits of carrying dogs between islands are contributing factor that triggers rabies cases in Provinces previously free of rabies. This study aims to qualitative risk assessment entry and spread of rabies in dogs into Sorong City of West Papua Province. Methods of collecting primary data obtained from expert opinions, questionnaires, interviews, and direct observation in the field. Secondary data is taken through search of scientific publications, surveillance results, unpublished data in the form of reports, and documents from authorized agencies. The results of study showed that release assessment was high, the incidence of rabies in dogs was 52%, and 180 cases of rabies in humans (lyssa) in Sulawesi, Maluku and North Maluku. The exposure assessment was high based on the presence of rabies transmite animal (RTA) traffic from endemic areas, 58% dogs, 38% cats, and 4% apes from Java 68% (Surabaya 50%, Jakarta 18%), Sulawesi 10% (Manado and Bitung), Maluku 14% (Ambon) and North Maluku 8% (Ternate). The consequence assessment is high because there is a single impact that is categorized as nationally significant. The estimated risk of getting into rabies is high. The potential pathways used in RTA traffic to Sorong City is by sea at 89.3% and air at 10.7%. The results of the study concluded that the qualitative risk assessment of entry and spread of rabies in dogs to the Sorong City of West Papua Province was high. All risk assessments have low uncertainty.
EVALUASI KINERJA PETUGAS VAKSIN RABIES DI KOTA AMBON Tagueha, Astri Dwyanti; Susetya, Heru; Budiharta, Setyawan
Jurnal Sain Veteriner Vol 29, No 2 (2011): DESEMBER
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3926.108 KB) | DOI: 10.22146/jsv.39516

Abstract

Study on the evaluation of rabies vaccinator performance and its associated factors on has been conduced.
EVALUASI KINERJA PETUGAS VAKSIN RABIES DI KOTA AMBON Tagueha, Astri Dwyanti; Susetya, Heru; Budiharta, Setyawan
Jurnal Sain Veteriner Vol 29, No 2 (2011): DESEMBER
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (3926.108 KB) | DOI: 10.22146/jsv.39517

Abstract

Study on the evaluation of rabies vaccinator performance and its associated factors on has been conduced.
Genetic Analysis of Glycoprotein Gene of Indonesian Rabies Virus Susetya, Heru; Naoto, Ito; Sugiyama, Makoto; Minamoto, Nobuyuki
Indonesian Journal of Biotechnology Vol 10, No 1 (2005)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (265.632 KB)

Abstract

The amino acid sequences of the Glycoprotein gene (G gene) of field rabies virus SN01-23 from Indonesiawas determined. This isolate showed homology of 93% in the ectodomain of the Glycoprotein gene to that of theRC-HL strain, which is used for production of animal vaccine in Japan. The high identity in the ectodomainbetween this field isolate and strain RC-HL suggest that the rabies animal vaccine used in Japan will be effectivefor rabies street viruses in Indonesia. Result of phylogenetic analysis using the nucleotide sequences of the Ggenes of rabies street viruses showed that SN01-23 from Indonesia is more closely related to a rabies virus fromChina than to viruses from Thailand and Malaysia. This genetic data and historical background suggest thatrabies viruses in China had been transferred to Indonesia through dogs brought by humans migrating from Chinato Indonesia.Keywords : Rabies virus, Glycoprotein gene, Ectodomain, Phylogenetic analysis
Molecular Study on The Pathogenicity of Avian Influenza Virus Wibowo, Haryadi M.; Susetya, Heru; Untari, Tri; Putri, Khrisdiana; Tabbu, Charles Rangga
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (157.738 KB)

Abstract

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.
DETECTION OF ANTIBIOTIC RESIDUES IN CHICKEN MEAT AND EGGS FROM TRADITIONAL MARKETS AT YOGYAKARTA CITY USING BIOASSAY METHOD Widiasih, Dyah Ayu; Drastini, Yatri; Yudhabuntara, Doddi; R. Daru Maya, F. Lintang; Sivalingham, Prisha Lini; Susetya, Heru; Nugroho, Widagdo Sri Nugroho Sri; Putri, M. Th. Khrisdiana; Primatika, Roza Azizah; Sumiarto, Bambang
Acta VETERINARIA Indonesiana 2019: Special Issues
Publisher : Bogor Agricultural University

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (450.823 KB) | DOI: 10.29244/avi.0.0.1-6

Abstract

Studies on antibiotic residues content in food of animal origin are currently needed to support veterinary public health programs. The present study was described bioassay method for the detection of antibiotic residues in chicken meat and eggs from traditional market at Yogyakarta City. A number of twenty-four chicken meat samples and 24 egg samples were taken from 8 traditional markets in Yogyakarta city. Samples were examined at Centre for Veterinary Wates, Yogyakarta, Indonesia using bioassay method for screening detection of penicillin, aminoglycoside, macrolide and tetracycline residues. This bioassay method using some bacteria, such as Bacillus stearothermophillus, B. cereus, B. subtilis, and Kocuria rizophila. A percentage of the results showed that 8.33% (2/24) samples of chickens tested positively contained the oxytetracycline antibiotic residues. Meanwhile, as much as 75% (18/24) samples of positive eggs contain penicillin antibiotic residues, positive residues of aminoglycoside amounted to 12.5% (3/24) and the positive residues of oxytetracycline also amounted to 12.5% (3/24).
FAKTOR-FAKTOR RISIKO RABIES PADA ANJING DI BALI (RISK FACTORS ANALYSIS FOR RABIES INDOGS IN BALI) Dibia, I Nyoman; Sumiarto, Bambang; Susetya, Heru; Putra, Anak Agung Gde; Scott-Orr, Helen
Jurnal Veteriner Vol 16 No 3 (2015)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

The efforts to eradicate rabies in Bali have been done for more than three years. However, therabiescases is still spreading. Thus, rabies virus continues to infect humans. A case-control study wasconducted to identify the risk factors associated with rabid dog in Bali. Cases were defined as dogsconfirmed having rabies by direct fluorescent antibody test (dFAT). Determination of sample amount ineach district was taken proportionally and samples were taken by using simple random sampling. A totalof 51 rabid dog cases between 2010 and 2011 and 102 uninfected rabies dogs as control were used in thisstudy. Possible associated factors were obtained by doing questionnaire. The data were subsequentlyanalyzed using chi-square (X2) and odds-ratio (OR) for possible association, which were ultimately analyzedby means of logistic regression to build up of model. This study revealed that factors associated with rabiddog were the status of rabies vaccination (X2= 55.538; P= 0.000; OR= 19.133; 95% CI= 8.015<OR<45.678),contact with other dog (X2= 43.659; P= 0.000; OR= 12.551; 95% CI= 5.541<OR<28.430),condition of dog(X2= 9.994; P= 0.002; OR= 3.019; 95% CI= 1.504<OR<6.058),number of raised dog (X2= 9.284; P= 0.002;OR= 2.962; 95% CI= 1.455<OR<6.027), and veterinary care (X2= 5.258; P= 0.022; OR= 2.444; 95% CI=1.125<OR<5.310). It was found an appropriate logit model to estimate probability of rabid dog events inBali province as follows : Logit Pr (rabies=1| x) = - 4.413 + 3.919 (status of rabies vaccination) + 3.457(contact with other dog). This study is expected to be used as a reference in order to improve rabies controleffectiveness in Bali.
Genetic Analysis of Glycoprotein Gene of Indonesian Rabies Virus Susetya, Heru; Naoto, Ito; Sugiyama, Makoto; Minamoto, Nobuyuki
Indonesian Journal of Biotechnology Vol 10, No 1 (2005)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (265.632 KB) | DOI: 10.22146/ijbiotech.7413

Abstract

The amino acid sequences of the Glycoprotein gene (G gene) of field rabies virus SN01-23 from Indonesiawas determined. This isolate showed homology of 93% in the ectodomain of the Glycoprotein gene to that of theRC-HL strain, which is used for production of animal vaccine in Japan. The high identity in the ectodomainbetween this field isolate and strain RC-HL suggest that the rabies animal vaccine used in Japan will be effectivefor rabies street viruses in Indonesia. Result of phylogenetic analysis using the nucleotide sequences of the Ggenes of rabies street viruses showed that SN01-23 from Indonesia is more closely related to a rabies virus fromChina than to viruses from Thailand and Malaysia. This genetic data and historical background suggest thatrabies viruses in China had been transferred to Indonesia through dogs brought by humans migrating from Chinato Indonesia.Keywords : Rabies virus, Glycoprotein gene, Ectodomain, Phylogenetic analysis