
Found 30 Documents

Bakteri Probiotik Dalam Budidaya Udang: Seleksi, Mekanisme Aksi, Karakterisasi, dan Aplikasinya Sebagai Agen Biokontrol Widanarni, Widanarni; Sukenda, Sukenda; Setiawati, Mia
Jurnal Ilmu Pertanian Indonesia Vol 13, No 2 (2008): Jurnal Ilmu Pertanian Indonesia
Publisher : Institut Pertanian Bogor

Show Abstract | Original Source | Check in Google Scholar | Full PDF (348.509 KB)


Bacterial disease attack occurs at the hatchery stage, which is considered to be the most serious threat, and often results in mass mortality of shrimp larvae by vibrosis which is that caused by a luminous bacterium identified as Vibrio harveyi. This research was carried out to obtain local isolates of probiotic bacteria that were able to inhibit the growth of V. harveyi and effectively apply it as a biocontrol of vibriosis in shrimp cultures. The research was carried out as follows: (1) In vitro and in vivo selection of probiotic bacteria candidates, (2) Study of the action mechanism and characterization of the selected pro biotic bacteria, (3) Study on application of the selected probiotic bacteria as a biocontrol agent in shrimp cultures. Results of in vitro and in vivo selection provided the best three isolates, which were 1Ub, SKT-b and Ua. The survival rate of shrimp larvae which were not only inoculated by V. harveyi but also with 1Ub, SKT-b and Ua probiotic bacteria were 88.33, 83.33, and 81.67% respectively; where as the positive control treatment (merely inoculated with V. harveyi) gave a 41.67% survival rate and the negative control (without bacterial addition) was 68.33%. Studies using a rifampicin resistant marker (RfR) demonstrated that the number of V. harveyi MR5339 RfR cells in treatments without probiotic addition were higher than the treatment with the probiotic bacteria, in dead larvae, living larvae, as well as in the culture media. Partial sequencing of the I6S-rRNA gene showed that the I Ub isolate was similar to Pseudoalteromonas piscicida, whereas the SKT -b and Ua isolates were similar to Vibrio alginolyticus. Selected probiotic bacteria could be applied directly to shrimp larva culture media, or orally through enrichment of both natural and artificial food. Keywords: Penaeus monodon larvae, probiotic bacteria, vibriosis 
Molecular identification of pathogenic bacteria and PCR specific primer design Aris, Muh.; Sukenda, Sukenda; Harris, Enang; Sukadi, Muh. Fatuhcri
e-Journal BUDIDAYA PERAIRAN Vol 1, No 3 (2013)
Publisher : e-Journal BUDIDAYA PERAIRAN

Show Abstract | Original Source | Check in Google Scholar | Full PDF (112.34 KB)


Management of healthy seaweed aquaculture and control of ice ice disease are important component in seaweed production. To support the integrated prevention of ice ice disease, information about genetic variation of bacterial pathogen and the availability of fast and accurate detection are required. This study aimed to identify bacterial pathogen based on gene sequence analysis 16S-rRNA, construction of specific PCR primer from gene sequent analysis 16S-rRNA from bacteria that had the highest pathogenicity. Gene 16S rRNA of bacteria that had the highest pathogenicity was amplificated with universal primer PCR domain forward primer 63f (5’-CAG GCC TAA CAC ATG CAA GTC-3’) and reverse primer 1387r (5’-GGG CGG WGT GTA CAA GGC-3’). DNA Sequence obtained was compared to data base European Bioinformatics Institute (EBI) BLASTN. Construction and feasibility analysis of primer pair was done using primer 3 program. Two specific primer PCR were successfully constructed namely aSEFM-F (5- CAGCCACACTGGAACTGAGA-3) and aSEFM-R(5 TTAGCCGGTGCTTCTTCTGT -3). Both primer reacted optimum at 60°C and produced 201 bp amplicon. Keywords: pathogenicity, gene 16S-rRNA, PCR, primer, specific
Water Quality and Sediment Profile in Shrimp Culture with Different Sediment Redox Potential and Stocking Densities Under Laboratory Condition Wiyoto, Wiyoto; Sukenda, Sukenda; Harris, Enang; Nirmala, Kukuh; Djokosetiyanto, Daniel
ILMU KELAUTAN: Indonesian Journal of Marine Sciences Vol 21, No 2 (2016): Ilmu Kelautan
Publisher : Marine Science Department Diponegoro University

Show Abstract | Original Source | Check in Google Scholar | Full PDF (369.507 KB)


Sediment quality has been considered as one of the prime factors influencing the environment quality that support maximum shrimp production.The aim of the study was toevaluate the effects of sediment redox potential and shrimp stocking density on the profile of some sediment and water quality parameters. Two factors randomized factorial design was applied, with stocking density (60 and 120 shrimps.m-2) as the first variable and sediment redox potential (-65 mV, -108 mV and -206 mV) as the second variable. Some significant changes in TP, total Mn, and total S concentrations in the sediment were observed after the experimentation (P<0.05). Sediment redox potential significantly affected the dissolved oxygen, TAN, NO2, NO3, and H2S concentrations in the water. Whereas shrimp stocking density affected all water quality parameters except H2S concentration. Significant interactions between redox potential and stocking densities were observed in the nitrite and alkalinity concentrations. The significant effects of both shrimp density and redox potential on the sediment and water parameters in particular those that are known to directly affect the shrimp welfare (e.g. oxygen, ammonia, nitrite and H2S) indicate that these variables are of important aspects in shrimp pond management. Furthermore, the results clearly showed that -206mV redox potential significantly reduced the dissolved oxygen concentration in the sediment-water interface and increased the generation of H2S in water column. Thereby, this redox potential level is not advisable for shrimp culture system. Keywords: redox potential, stocking density.
Specific Immune Response Kinetics and Mortality Patterns of Tilapia Oreochromis niloticus on Post-Cocktail Vaccination Period against the Infection of Aeromonas hydrophila and Streptococcus agalactiae Sukenda, Sukenda; Sumiati, Tuti; Nuryati, Sri; Lusiastuti, Angela Mariana; Hidayatullah, Dendi
Journal Omni-Akuatika Vol 13, No 2 (2017): Omni-Akuatika November
Publisher : Fisheries and Marine Science Faculty - Jenderal Soedirman University

Show Abstract | Original Source | Check in Google Scholar | Full PDF (214.583 KB)


ABSTRACTFish vaccination aims to induce a specific immune response indicated by an increase of antibodies in vaccinated fish. However, in accordance with time the presence of antibodies will continue to decline. The purpose of this study was to determine the kinetics of specifik immune response and trend mortality against Aeromonas hydrophila and Streptococcus agalactiae on tilapia following vaccination with cocktail vaccine. Fish vaccinated through immersion for 30 minutes in a solution of diluted vaccine. Challenge test was performed for three periods, on day 22, 50, and 78 post-vaccination, fish were challenged with single infection of A. hydrophila 108 cfu. mL-1 and S. agalactiae 104 cfu. mL-1 and co-infection of both bacteria by intraperitoneal. During rearing, the blood fish were taken for determining of serum antibodies, and its  measured by ELISA. The results showed that the concentration of specific antibodies vaccinated fish were significantly higher than the control. The basal antibody levels of A. hydrophila before vaccination were higher than S. agalactiae with OD of 0.104 and 0.069 respectively. The maximum  antibody  response  was  reached  within  70  days  of  the  A. hydrophila OD= 0.264 and 56 days against S. agalactiae OD= 0.188. The mortality rate in the control group was significantly higher than vaccinated on all types and each challenge test period. The trend of mortality due to a single infection of A. hydrophila and co-infections occur more quickly than by S. agalactiae. Lowest mortality occurred in the vaccinated group at 50 day tested challenge.Keywords: kinetics antibody, Aeromnas hydrophila, Streptococcus agalactiae, Oreochromis niloticus
ANALISIS USAHA PEMBIBITAN MANGLID (Manglieta Glauca BI) Sukenda, Sukenda; Sujaya, Dedi Herdiansah; Hardiyanto, Tito
Publisher : Universitas Galuh Ciamis

Show Abstract | Original Source | Check in Google Scholar


Penelitian ini bertujuan untuk mengetahui: (1) Besarnya biaya, penerimaan dan pendapatan dari usaha pembibitan manglid pada Kelompok Tani balebat di Desa Neglasari Kecamatan Salawu Kabupaten Tasikmalaya dalam satu kali proses produksi. (2) Besarnya R/C dari usaha pembibitan manglid pada Kelompok Tani balebat di Desa Neglasari Kecamatan Salawu Kabupaten Tasikmalaya dalam satu kali proses produksi. Penelitian ini dilaksanakan Pada Kelompok Tani Balebat di Desa Neglasari Kecamatan Salawu Kabupaten Tasikmalaya dengan menggunakan metode studi kasus. Pengambilan sampel untuk Kelompok Tani Balebat di Desa Neglasari Kecamatan Salawu Kabupaten Tasikmalaya menggunakan Purposive Sampling (sampel yang sengaja dipilih atau tidak acak), sedangkan penarikan sampel untuk petani dilakukan dengan cara sensus. Hasil penelitian menunjukkan bahwa: Biaya yang dikeluarkan untuk melaksanakan usaha pembibitan manglid per hektar dalam satu kali proses produksi adalah Rp 120.868.618,74. Penerimaan yang diperoleh dalam usaha pembibitan manglid per hektar dalam satu kali proses produksi adalah Rp 251.852.532 dan pendapatan yang diperoleh dari usaha pembibitan manglid per hektar dalam satu kali proses produksi adalah Rp 130.983.913,26. Besarnya R/C usaha pembibitan manglid pada Kelompok Tani Balebat di Desa Neglasari Kecamatan Salwu Kabupaten Tasikmalaya adalah 2,083 artinya untuk setiap Rp 1 biaya yang dikeluarkan dalam melaksanakan usaha pembibitan manglid diperoleh penerimaan Rp 2,083 sehingga pendapatan yang diperoleh sebesar 1,083 Karena Nilai R/C > 1 maka usaha pembibitan manglid tersebut menguntungkan dan layak untuk dilaksanakan.Kata kunci : pembibitan manglid, usahatani
APLIKASI SINBIOTIK UNTUK PENCEGAHAN INFEKSI INFECTIOUS MYONECROSIS VIRUS PADA UDANG VANAME (Litopenaeus vannamei) (Synbiotic Application for Prevention of Infectious Myonecrosis Virus Infection in White Shrimp (Litopenaeus vannamei)) Widanarni, Widanarni; Sukenda, Sukenda; Septiani, Ghita Ryan
Jurnal Kedokteran Hewan Vol 10, No 2 (2016): J. Ked. Hewan
Publisher : Syiah Kuala University

Show Abstract | Original Source | Check in Google Scholar | Full PDF (318.787 KB)


This study aimed to evaluate the effectiveness of dietary synbiotic at different giving frequencies on growth, immune responses, and resistance of white shrimp infected by infectious myonecrosis virus (IMNV). Synbiotic used in this study was combination of probiotic Vibrio alginolyticus SKT-b and prebiotic oligosaccharides extracted from sweet potatoe (Ipomoea batatas L). Doses of probiotic and prebiotic used were 1% and 2% (w/w), respectively. The white shrimps (0.493±0.035 g) were divided into five treatments consisting of A and B (without supplementation of synbiotic: (A) positive control; (B) negative control), C (daily synbiotic supplementation), D (twice a week synbiotic supplementation), and E (weekly synbiotic supplementation). After 30 days of feeding trial, white shrimps were infected by IMNV (except negative control). The results showed that daily growth rate of white shrimp on all synbiotic treatments (C, D, and E) ranged from 6.93±0.025-6.97±0.019% and had higher values than controls (A and B) (P<0.05). Meanwhile, feed conversion value in C and D (1.54±0.142 and 1.58±0.117) were lower than controls (P<0.05). Supplementation of synbiotic with different frequencies also affected survival rate of white shrimp after the challenge test with IMNV; daily synbiotic supplementation (C) resulted in a 50% higher survival rate than positive control (P<0.05). This was associated with immune responses parameters values of synbiotic treatment (before and after the challenge test) which were better than positive control. In conclusion the addition of synbiotic in feed resulted in higher growth performances, immune responses,and resistance of white shrimp to IMNV infection.
TOKSISITAS SEL UTUH DAN EXTRACELLULAR PRODUCT (ECP) Streptococcus agalactiae β-HEMOLITIK DAN NON-HEMOLITIK PADA IKAN NILA (Oreochromis niloticus) Suhermanto, Achmad; Sukenda, Sukenda; Zairin Jr., Muhammad; Lusiastuti, Angela Mariana; Nuryati, Sri
Jurnal Riset Akuakultur Vol 13, No 4 (2018): (Desember 2018)
Publisher : Pusat Riset Perikanan, Badan Riset dan Sumber Daya Manusia Kelautan dan Perikanan

Show Abstract | Original Source | Check in Google Scholar | Full PDF (126.738 KB)


Bakteri Streptococcus agalactiae tipe β-hemolitik dan non-hemolitik menjadi agen penyebab infeksi streptococcosis yang mengakibatkan kematian dan kerugian besar pada budidaya ikan nila. Penelitian ini bertujuan untuk membandingkan toksisitas sel utuh dan extracellular product (ECP) bakteri b-hemolitik dan non-hemolitik yang diinjeksikan pada ikan nila. Karakterisasi S. agalactiae berdasarkan SNI dan API 20 STREP, serta pemisahan protein dengan metode SDS-PAGE. Pengujian toksisitas dilakukan dengan cara menginjeksikan sel utuh dan ECP S. agalactiae secara intraperitoneal (IP) dengan dosis 0,1 mL ekor-1. Hasil uji biokimia, dan konfirmasi dengan API 20 STREP menunjukkan bahwa semua isolat positif S. agalactiae. Fraksinasi protein pada sel utuh bakteri diperoleh pita protein masing-masing sebanyak sembilan dan tujuh pita pada tipe β-hemolitik dan non-hemolitik. Fraksinasi ECP teridentifikasi pada β-hemolitik sebanyak tujuh pita dan non-hemolitik empat pita protein. Konsentrasi protein sel utuh dan ECP b-hemolitik lebih besar dibandingkan bakteri non-hemolitik. Gejala abnormalitas lebih cepat terjadi pada ikan nila yang diinjeksi ECP bakteri b-hemolitik dan berbanding lurus dengan kematian sebanyak 91%-100% pada jam ke-13 pascainjeksi. Hasil ini menunjukkan bahwa ECP bakteri S. agalactiae β-hemolitik lebih virulen dibandingkan tipe non-hemolitik. Hingga akhir pemeliharaan tidak ada kematian pada ikan yang diinjeksi sel utuh bakteri S. agalactiae b-hemolitik dan non-hemolitik. Studi histopatologi ikan yang diinjeksi ECP S. agalactiae pada organ hati, limpa, otak, dan ginjal menunjukkan adanya kongesti, hemoragi, dan nekrosis.The β-hemolytic and non-hemolytic biotype of Streptococcus agalactiae are the agents that cause streptococcosis infection which resulted in high mortality and major losses in tilapia culture. This study aimed to compare the toxicity of whole cell and extracellular product (ECP) b-hemolytic and non-hemolytic bacteria from injected tilapia. Characterization of S. agalactiae was based on SNI and API 20 STREP and protein separation by SDS-PAGE method. Toxicity test was carried out by injecting whole cells and ECP S. agalactiae intraperitoneally with a dose of 0.1 mL fish-1. The results of biochemical tests, with confirmation by API 20 STREP showed that all isolates were positive for S. agalactiae. Protein fractionation of whole bacterial cells obtained as many as nine and seven bands of protein in b-hemolytic and non hemolytic biotype, respectively. ECP fractionation was identified in β-hemolytic biotype as many as seven bands and four protein bands in non-hemolytic. The whole cell protein concentration and ECP β-hemolytic were higher than non-hemolytic bacteria. Symptoms of abnormalities occurred faster in tilapia which was injected with ECP b-hemolytic bacteria and had positive correlation with 91%-100% mortalities at the 13th hours post-injection. This results indicated that ECP of S. agalactiae β-hemolytic are more virulent than non-hemolytic. Until the end of the trial, there were no deaths in fish injected with whole cells of b-hemolytic and non-hemolytic S. agalactiae. Histopathological studies of ECP-injected fish S. agalactiae in the liver, spleen, brain, and kidneys showed congestion, hemorrhage, and necrosis. 
STATUS KESEHATAN IKAN LELE (Clarias gariepinus) YANG MENERIMA PAKAN BERSUPLEMEN KOMBINASI DAUN SIRIH (Piper betler leaf), JAMBU BIJI (Psidium guajava leaf), DAN KIPAHIT (Tithonia diversifolia leaf) Nafiqoh, Nunak; Sukenda, Sukenda; Junior, Muhamad Zairin; Alimuddin, Alimuddin; Lusiastuti, Angela Mariana; Avarre, Jean-Christophe
Jurnal Riset Akuakultur Vol 13, No 4 (2018): (Desember 2018)
Publisher : Pusat Riset Perikanan, Badan Riset dan Sumber Daya Manusia Kelautan dan Perikanan

Show Abstract | Original Source | Check in Google Scholar | Full PDF (97.799 KB)


Tanaman obat telah banyak digunakan sebagai bahan pencegah dan pengobatan penyakit pada ikan budidaya. Penelitian ini ditujukan untuk mengetahui status kesehatan ikan lele (C. gariepinus) yang menerima pakan dengan suplemen tanaman obat kombinasi dari daun sirih, jambu biji, dan kipahit melalui pengamatan gambaran darah dan histologi ginjal sebagai organ yang memproduksi darah. Kombinasi satu merupakan kombinasi dari ketiga daun tanaman obat masing-masing sebanyak 33%, kombinasi dua juga terdiri dari daun sirih, jambu biji, dan kipahit masing-masing sebanyak 5%:19%:76%, dan kontrol yaitu pakan tanpa penambahan tanaman obat. Gambaran darah dan histologi ginjal diamati pada minggu ketiga setelah pemberian pakan. Hasil pengamatan gambaran darah menunjukkan bahwa terdapat peningkatan jumlah sel darah merah pada ikan yang menerima pakan perlakuan dibandingkan dengan kontrol (0,4 ± 0,14). Namun tidak terdapat perbedaan nyata antara jumlah sel darah merah dari kelompok perlakuan kombinasi satu dan dua (1,5 ± 0,17 dan 1,4 ± 0,1). Jumlah sel darah putih pada kelompok perlakuan juga meningkat dibandingkan dengan kelompok kontrol (10,5 ± 0,46), namun tidak terdapat perbedaan nyata antara kelompok perlakuan kombinasi satu dan dua (15,1 ± 1,19 dan 17,6 ± 1,14). Hasil pengamatan histologi terlihat jaringan hematopoietik organ ginjal dari kelompok yang menerima perlakuan berproliferasi lebih banyak dibandingkan kelompok kontrol. Namun tidak ada pengaruh pada nilai hemoglobin dan persentase leukosit diferensiasi antara kelompok perlakuan dan kontrol. Penambahan daun tanaman obat dalam pakan ikan mampu meningkakan status kesehatan dari ikan lele.Medicinal herbs have been traditionally used as prophylactic and therapeutic supplement to treat diseases in aquaculture. This study was aimed to improve the health quality of catfish (C. gariepinus) through feeding on diets enriched with a combination of betel, guava, and tithonia as medicine by analyzing hematology and histology of kidney as blood producing organ. Diet-one was feed enrich with 33% of each plant. Diet-two was feed enriched with betel, guava, and tithonia at a proportion of 5%,19%, and 76%, respectively. Control diet was fed without the plants’ supplementation. Hematology and histology of fish kidney were observed after fish received three-week feed treatments. The results showed that there was an increase of erythrocyte levels in the treated fish groups fed with diet-one and diet-two compared with the control (0.4 ± 0.14). However, no significant differences of erythrocyte level were observed between fish groups fed with diet -one and die-two (1.5 ± 0.17 and 1.4 ± 0.1). Leucocyte levels also increased in the treated fish group with diet-one and diet-two compared to the control (10.5 ± 0.46). However, there was no significant difference of leucocyte level between the fish group feed with diet-one and diet-two (15.1 ± 1.19 and 17.6 ± 1.14). Histological observations found that there were more hematopoietic tissues in the fish kidney of proliferated treated group than the control group. However, there was no effect on hemoglobin level and leukocyte percentage differentiation between the treatment and control groups. This study concludes that medicinal herbs as enrichment ingredients in fish diet can increase the health quality of fish.
NONSPECIFIC IMMUNE RESPONSE AND RESISTANCE OF Litopenaeus vannamei FED WITH NUCLEOTIDE, β-GLUCAN, AND PROTAGEN DIETS Manoppo, Henky; Sukenda, Sukenda; Djokosetiyanto, Daniel; Sukadi, Mochamad Fatuchri; Harris, Enang
Indonesian Aquaculture Journal Vol 5, No 1 (2010): (June 2010)
Publisher : Pusat Penelitian dan Pengembangan Perikanan, Badan Penelitian dan Pengembangan Kelautan da

Show Abstract | Original Source | Check in Google Scholar | Full PDF (110.141 KB)


The objective of this research was to evaluate the nonspecific immune response and resistance of Litopenaeus vannamei fed with nucleotide, β–glucan, and protagen diets. Shrimp juveniles with an average weight of 5.39±0.56 g were reared in glass aquaria at a density of 15 shrimps/aquarium. Shrimps were fed three times a day for four weeks at a feeding rate of 3%/bw/day. Treatment diets consisted of A: basal diet (without immunostimulant), B: β–glucan, C: protagen, and D: nucleotide, each with three replicates. At the end of feeding period, the shrimps were intramuscularly injected with Vibrio harveyi 0.1 x 106 cfu.shrimp-1. Total haemocyte count (THC) of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p=0.01), but not different compared to shrimp fed with protagen-diet. PO activity also increased significantly in shrimp fed with nucleotide-diet (p=0.02). β–glucan diet could also increase THC and PO activity, but compared to the control, the increase was not significantly different. Overall, PO activity of shrimp fed with nucleotide, β–glucan, and protagen diets was high (&gt;0.35). Oral administration of nucleotide, β–glucan, and protagen for four consecutive weeks significantly increased resistance of shrimp to disease (&lt;0.01) where the highest resistance rate was observed on shrimp fed with nucleotide-diet. Growth of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p&lt;0.01), as well as to β–glucan, and protagen-treated shrimp. As a conclusion, supplementation of nucleotide into shrimp pellet enhanced nonspecific immune response and growth performance better than β-glucan, and protagen.
TOKSISITAS PROTEIN 89 kDa PRODUK EKSTRASELULER Streptococcus agalactiae PADA IKAN NILA (Oreochromis niloticus) Amrullah, Amrullah; Sukenda, Sukenda; Harris, Enang; Alimuddin, Alimuddin; Lusiastuti, Angela Mariana
Jurnal Riset Akuakultur Vol 10, No 3 (2015): (September 2015)
Publisher : Pusat Riset Perikanan, Badan Riset dan Sumber Daya Manusia Kelautan dan Perikanan

Show Abstract | Original Source | Check in Google Scholar | Full PDF (598.612 KB)


Identifikasi protein toksin yang bersifat antigenik dari produk ekstraselular (ECP) crude Streptococcus agalactiae penting dilakukan untuk pengembangan vaksin protein toksoid. Penelitian ini bertujuan untuk mengevaluasi toksisitas protein dengan berat molekul 89 kDa dari ECP Streptococcus agalactiae hasil fraksinasi dengan SDS-PAGE (ECPP89). Ikan nila dengan bobot sekitar 25 g masing-masing diinjeksi secara intraperitonial dengan protein ECPP89 dosis 1, 2, 4, 8, dan 16 μg/mL/ekor ikan (secara berturut-turut diberi kode ECPP89-1, ECPP89-2, ECPP89-4, ECPP89-8, dan ECPP89-16). Sebagai kontrol positif ikan diinjeksi dengan bakteri utuh S. agalactiae 1 x 104 cfu/mL (WCB) dan ECP crude S. agalactiae (ECPC), sementara kontrol negatif ikan diinjeksi larutan PBS. Ikan dipelihara selama 15 hari dengan kepadatan 10 ekor (70 L air). Hasil penelitian menunjukkan bahwa ikan nila yang diinjeksi dengan ECPP89 mengalami gejala seperti perubahan morfologi, perubahan nafsu makan, dan perubahan renang ikan. Mortalitas pada perlakuan ECPP89 secara umum lebih tinggi dibandingkan dengan ECPC, namun lebih rendah (p&lt;0,05) dibandingkan dengan WCB. Mortalitas ikan pada perlakuan ECPP89-4, ECPP89-8, dan ECPP89-16 tidak berbeda tetapi secara signifikan lebih tinggi dibandingkan dengan ECPC dan dua dosis perlakuan ECPP89 lainnya (p&lt;0,05). Ikan kontrol negatif tidak mengalami kematian maupun perubahan klinis. Hasil ini menunjukkan bahwa ECPP89 merupakan protein toksin dari ECP S. agalactiae.