
Buletin Veteriner Udayana Vol. 2 No. 2 Agustus 2010
Publisher : Buletin Veteriner Udayana

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (71.575 KB)


Normally, fluids lost through physiological activities such as respiration, sweating, panting,and urination. Abnormal lost of fluids occurs through vomiting, diarrhea, fever or excessiveurination and disease processes. The purpose of fluid therapy is to replenish the volume ofblood circulations and to replace the normal and excessive fluids lost. Dogs and cats needfluid intake 40 – 60 ml/kg body weight daily to replenish fluids lost through urination andrespiration. In a condition of excessive fluids lost such as diarrhea and vomiting the animalbody needs water replacement as much as 70 – 80% within 24 hours or instantaneouslyreplacement half of the water losses within the first 4 to 8 hours. In conclusions, fluidtherapy is one way for treating emergency condition animals with intensice care. Properlycare should be considered when choosing the right solutions for the fluid therapy
Homeostasis Cairan Tubuh pada Anjing dan Kucing Anthara, I Made Suma; Suartha, I Nyoman
Buletin Veteriner Udayana Vol. 3 No. 1 Pebruari 2011
Publisher : Buletin Veteriner Udayana

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (71.575 KB)


The body’s fluid is compartmentalized into two major divisions: the intracellular fluid(ICF) and the extracellular fluid (ECF). The ECF which is also called the internalenvironment of the body is in constant motion throughout the body. The ECF contains largeamounts of sodium chloride, and bicarbonate. The ICF contains large amounts potassium andphosphate. Transported of water and nutrient through cell membrane occurs by diffusion,osmosis and sodium-potassium pumps. The homeostasis of body fluid is maintains bykidney.
Jurnal Veteriner Vol 8, No 2 (2007)
Publisher : Jurnal Veteriner

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (71.575 KB)


The porpuse of study was to explore the potential use of? anti tetanus IgY from eggs yolk as a substitute for anti tetanus serum raised in ?horses. The eggs were collected from chickens which have previously been immunized with tetanus toxoid. Neutralization potency test of anti tetanus IgY determined by ?Spearman-Karber method.? The highest mean titer of anti tetanus of egg yolk was 80.16 ? 33.55 IU/ml and the lowest was 1.69 ? 0.63 IU/ml. The concentration? of purified IgY was 1.644 ? 0.424 mg/ml. Spearman-Karber value of potency of anti tetanus IgY are 35 IU/ml. ?This research concluded that Chickens was capable of produced of anti tetanus in eggs yolk with value of potency are 35 IU/ml.
Jurnal Veteriner Vol 7, No 4 (2006)
Publisher : Jurnal Veteriner

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (71.575 KB)


Metode ekstraksi protein kuning telur dengan polyethylene glycol (PEG) yang dikombinasi dengan ammonium sulfat
THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER Suartha, I Nyoman; Mahardika, I Gusti Ngurah Kade; Sri Candra Dewi, Ida Ayu; Dias Nursanty, Ni Ketut; L.S Kote, Yosaphat; Dwi Handayani, Anita; Ayu Suartini, I Gusti Agung
Jurnal Veteriner Vol 9, No 1 (2008)
Publisher : Jurnal Veteriner

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (71.575 KB)


A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR) technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward) and 5’- CAAGATAACCATGTACGGTGC-3’ (backward). A single band of 300 bp which was specific for canine distemper virus CDV) was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Perbandingan Sekuens Konsensus Gen Hemaglutinin Virus Avian Influenza Subtipe H5N1 Asal Unggas di Indonesia dengan Subtipe H5N2 dan H5N9 Kade Mahardika, I Gusti Ngurah; Suartha, I Nyoman; Suardana, Ida Bagus Kade; Yuniati Kencana, I Gusti Ayu; Teguh Wibawan, I Wayan
Jurnal Veteriner Vol 10, No 1 (2009)
Publisher : Jurnal Veteriner

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (71.575 KB)


Consensus sequence of hemagglutinin (HA) gene of avian influenza viruses of H5N1 subtype isolatedfrom fowl in Indonesia – hereafter named as H5N1_Indonesia – is compared with that of H5N2 and H5N9viruses. Sequence information were downloaded from the public database GeneBank. The genetic distancesand nucleotide as well as its deduced amino-acid sequence alignment were analysed. At nucleotide level,genetic distances of HA between H5N1_Indonesia to H5N2 and H5N9 are 16.2% and 9.6%, respectively.At amino-acid level, the distances are 9.7% and 6.8%. The genetic distances of HA1 fragments are 19.0%(H5N1_Indonesia – H5N2) and 10.9% (H5N1_Indonesia – H5N9). At amino-acid, level the genetic distancesof HA1 are 13.1% (H5N1_Indonesia-H5N2) and 8.8% (H5N1_Indonesia – H5N9). All three subtypes havedifferent glycosilation motive and variation of amino-acid sequence of four antigenic sites. The consequenceof those facts is discussed.
Jurnal Veteriner Vol 10, No 2 (2009)
Publisher : Jurnal Veteriner

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (71.575 KB)


A study has been carried out to map the distribution pattern of poultry from traditional market toreduce the transmission risk of avian influenza virus. The data were collected from threes markets wherepoultry are sold, namely in Bringkit of Badung Regency, Kumbasari of Denpasar City, and Kediri ofTabanan Regency. Data collections was based on interviews using questionnaire. Poultry from all marketsare distributed throughout Bali. Poultry are traded mainly for religious ceremony and immediatelyslaughtered as it arrives at the consumer’s house. The distribution pattern of poultry seems to play asignificant role in the disseminations of avian influenza virus. The right implementation of biosecurity intraditional markets is highly recommended to curb the risk.
Analisis Faktor Risiko Penyakit Distemper pada Anjing di Denpasar Krisna Erawan, I Gusti Made; Suartha, I Nyoman; Sapta Budiari, Emy; Mustikawati, Diana; Batan, I Wayan
Jurnal Veteriner Vol 10, No 3 (2009)
Publisher : Jurnal Veteriner

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (71.575 KB)


A study was conducted to identify the risk factors of canine distemper in Denpasar, Bali. Risk factorsfor canine distemper were characterized using hospital records of private veterinary practitioners. Thisstudy showed that there was no difference in the susceptibility to canine distemper virus infection betweenmales and females. The occurrence of canine distemper disease is not significantly affected by the season.The risk of canine distemper disease for young dogs, between 0 and 1 year was 4.95-fold increase ascompared the risk of disease for dogs that were older than 1 year (Oods-Ratio: 4.95). Incomplete vaccinationwas associated with a 3.77-fold increase in the risk of canine distemper (Oods-Ratio: 3.77).
Deteksi Virus Classical Swine Fever di Bali dengan RT-PCR Wirata, I Wayan; Ayu Sri Chandra Dewi, Ida; Narendra Putra1,, I Gusti Ngurah; Oka Winaya, Ida Bagus; Kade Suardana3,, Ida Bagus; Komala Sari, Tri; Suartha, I Nyoman; Kade Mahardika, I Gusti Ngurah
Jurnal Veteriner Vol 11, No 3 (2010)
Publisher : Jurnal Veteriner

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (71.575 KB)


Classical Swine Fever (CSF) virus has been confirmed for the first time in pig in Bali. The object of thisstudy was suspected CSF cases diagnosed at the diagnostic laboratory assistantship of the Faculty ofVeterinary Medicine, Udayana University, in 2007-2008. Total number of cases was 12. Case recordsincluded the signalment of case (breed, age, body weight, and the origin of respective case), clinical signs,post-mortem lesions, and histological pictures. CSF virus was confirmed using the standardized reversetranscriptase-polymerase chain reaction (RT-PCR) for CSF from European Union. One RT-PCR productwas sequenced. CSF virus was confirmed in seven out of 12 cases (58%). The cDNA sequence wasconfirmed to be specific of CSF E2 protein coding region with 98% homology to one isolate from China thatwas available in GeneBank. Further works are recommended to elucidate the sensitivity of RT-PCR, toclarify some differential diagnose, and to find out the genetic variation of CSF virus in Bali.Key words: classical swine fever virus, Bali, RT-PCR
Variasi Respon Pembentukan IgY terhadap Toxoid Tetanus dalam Serum dan Kuning Telur pada Individu Ayam Petelur Teguh Wibawan, I Wayan; Bayu Prakoso Darmono, Iman; Suartha, I Nyoman
Jurnal Veteriner Vol 11, No 3 (2010)
Publisher : Jurnal Veteriner

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (71.575 KB)


The variation of response on the production of specific IgY to tetanus toxoid among chickenin serum and egg yolk was observed in this study. Chicken showed relatively late response inproducing specific IgY in serum, around 59 days were needed to have a positive precipitationreaction of complex IgY-tetanus toxoid in the immunodiffusion test (agar gel precipitation test/AGPT). The presence of IgY in egg yolk could be detected one week after positive reations inserum was observed. The positive reaction in AGPT mostly related with the positive reaction inELISA, eventhough the variation of titer values were observed among chicken sera and egg yolk.This response variation might be related with the different of physiological status of the chicken.
Co-Authors Anak Agung Gde Oka Dharmayudha Anak Agung Sagung Kendran Anita Dwi Handayani Arini Nur Handayani, Arini Nur Arini Nurhandayani BAMBANG PONTJO PRIYOSOERYANTO Bibiana W. Lay Boro, Saptarima Eka Estiani Dewi, Desak Made Wiga Puspita Diana Mustikawati Duarsa, Bima Satya Agung EKA MAHARDHIKA RATUNDIMA Emy Sapta Budiari Eustokia Yulisa Madu, Eustokia Yulisa Gusti Ayu Yuniati Kencana I Gede Soma I Gusti Agung Arta Putra, I Gusti Agung Arta I Gusti Agung Ayu Suartini I Gusti Ayu Yuniati Kencana I Gusti Made Krisna Erawan I Gusti Made Krisna Erawan, I Gusti Made Krisna I Gusti Ngurah Badiwangsa Temaja I GUSTI NGURAH DIBYA PRASETYA I GUSTI NGURAH KADE MAHARDHIKA I Gusti Ngurah Kade Mahardika I Gusti Ngurah Kade Mahardika I Gusti Ngurah Mahardika I Gusti Ngurah Narendra I Gusti Ngurah Narendra Putra I Gusti Ngurah Narendra Putra I Gusti Ngurah Narendra Putra1, I Gusti Ngurah Narendra, I Gusti Ngurah I Gusti Ngurah Sudisma I KADEK SAKA WIRYANA I Ketut Gunata I Ketut Gunatha, I Ketut I Komang Wahyu Yuliana, I Komang Wahyu I Made Dira Swantara I Made Kardena I Made Kota Budiasa, I Made Kota I Made Merdana I Made Sukada I MADE SUMA ANTARA I Made Suma Anthara I Nengah Kerta Besung I Nengah Wandia I Nyoman Sadra Dharmawan I Putu Gede Yudhi Arjentinia, I Putu Gede Yudhi I Wayan Batan I Wayan Teguh Wibawan I WAYAN TEGUH WIBAWAN I Wayan Wirata Ida Ayu Sri Candra Dewi Ida Ayu Sri Chandra Dewi Ida Bagus Kade Suardana Ida Bagus Kade Suardana3, Ida Bagus Oka Winaya Iman Bayu Prakoso Darmono Iwan Harjono Utama Kencana, Gusti Ayu Kencana, Gusti Ayu Yunianti Ketut Budiasa Ketut Sepdyana Kartini, Ketut Sepdyana Kristiana Yoaltiva Jinorati, Kristiana Yoaltiva Kristina Kristina Laksmi, Luh Kadek Nanda Luh Dewi Anggreni Luh Made Sudimartini Lusiana Lasmari Siahaan Made Suma Anthara Megariyanthi, Ni Putu Arie Muh Ramadhan Muhammad Ulqiya Syukron Nainggolan, Daniel Raja Bonar Ni Ketut Dias Nursanty Ni Ketut Suwiti Ni Made Ayu Sintya Paramita, Ni Made Ayu Sintya Ni Made Rita Krisna Dewi Ni Made Ritha Krisna Dewi NI MADE RITHA KRISNA DEWI Ni Made Ritha Krisna Dewi Ni Made Ritha Krisna Dewi2 Priska Mariane Serang, Priska Mariane Putri, Ayu Chitra Adhitya Putu Ayu Sisyawati Putriningsih Ratu Shinta Mayasari Reny Septyawati Retno Damayanti Soejoedono Samosir, Hartina Saputra, Nengah Tegar Sayu Raka Padma Wulan Sari, Sayu Raka Padma Wulan Sri Kayati Widyastuti Sri Kayati Widyastuti Sry Agustina Tiara L Rona, Tiara Tobing, Agatha Seren Lumban TRI KOMALA SARI Tri Komala Sari Tri Suci Galingging, Tri Suci Vivi Indrawati Wayan Wirata, Wayan Widyanti, Agnes Indah Wirawan, I Gede WIWIK SUSANAH RITA Yosaphat L.S Kote