Articles

Found 24 Documents
Search

Neutron-Gamma Pulse Shape Discrimination with a NE-213 Liquid Scintillator by Using Digital Signal Processing Combined with Similarity Method Mardiyanto, Mardiyanto
Atom Indonesia Vol 34, No 2 (2008): July 2008
Publisher : PPIKSN-BATAN

Show Abstract | Original Source | Check in Google Scholar | Full PDF (4054.209 KB)

Abstract

Neutron-Gamma Pulse Shape Discrimination with a NE-213 Liquid Scintillator by Using Digital Signal Processing Combined with Similarity Method. Measurement of mixed neutron-gamma radiation is difficult because a neuclear detector is usually sensitive to both radiations. A new attempt of neutron-gamma pulse shape discrimination for a NE-213 liquid scintillator is presented by using digital signal processing combined with an off-line similarity method. The output pulse shapes are digitized with a high speed digital oscilloscope. The n-γ discrimination is done by calculating the index of each pulse shape, which is determined by the similarity method, and then fusing it with its corresponding pulse height. Preliminary results demonstrate good separation of neutron and gamma-ray signals from a NE-213 scintillator with a simple digital system. The results were better than those with a conventional rise time method. Figure of Merit is used to determine the quality of discrimination. The figure of merit of the discrimination using digital signal processing combined with of line similarity method are 1.9; 1.7; 1.1; 1.1; and 0.8 ; on the other hand by using conventional method the rise time are 0.9; 0.9; 0.9; 0.7; and 0.4 for the equivalent electron energy of 800 ; 278 ; 139 ; 69 ; and 30 keV.
PARALLEL BEAM NEUTRON COMPUTED TOMOGRAPHY RECONSTRUCTION WITH VARIOUS FILTERS Mardiyanto, Mardiyanto; Bharoto, Bharoto; Sutiarso, Sutiarso; Ummi, Maharini Ahsani
Jurnal Iptek Nuklir Ganendra Vol 17, No 2 (2014)
Publisher : BATAN

Show Abstract | Original Source | Check in Google Scholar | Full PDF (29.627 KB)

Abstract

This paper presents a simple calculation using the MatLab application code for five different filter functions to obtain the best image quality for parallel beam neutron computed tomography. Shepp-Logan, Ramachandran-Lakshminarayanan, Cosine, Hamming and Hann Filter and without filter were used for a cross-section of a car coil ignitor reconstruction. The reconstruction was also done by varying the number of projections namely 180, 90, 45 and 12. The quality of the image can be determined by viewing the image directly or by using grey level curve to show the signal to noise image. The good images were determined by their signal-to-noise ratio (SNR) value. The high SNR values were obtained from the images which were reconstructed by using hamming and Hann filter. On the other hand the lowest SNR was obtained when the image was reconstructed without any filter. The number of the projections were also influenced the image quality, the more the projection number is used the better the image quality is obtained.
Pressure Dependence of Crystal Structure and Ionic Conductivity on Composite Glass (AgI)0.7(AgPO3)0.3 Suminta, S.; Kartini, E.; Mardiyanto, Mardiyanto; Adi, W.A.
Atom Indonesia Vol 31, No 2 (2005): July 2005
Publisher : PPIKSN-BATAN

Show Abstract | Original Source | Check in Google Scholar | Full PDF (543.202 KB)

Abstract

The superionic composite glass, (AgI)0.7(AgPO3)0.3 has been succesfully synthesized by melt quenching method. The crystall structure of coin type composite glass at various  pressure of 100, 300 and 700 kg/cm2 have been measured by using an X-ray Difractometer at PTBIN-BATAN. The X-ray difraction pattern shows some Bragg peaks    correspond to the crystaline γ-AgI. The increasing of pressure result the peaks become broaden and shift to the lower angle. This indicates that the crystal size is decreasing and the microstrain is increasing. Three strong peaks at (111), (220) and (311) have been analyzed by using a Gaussian  Fitting. Based on  calculation, crystal size (D) of (AgI)0.7(AgPO3)0.3 at pressures of 100, 300 and 700 kg/cm2 are 1114 Å, 13165 Å and 7240 Å respectively, while  microstrain values (η)  are 4 x 10-3 (1), 7.5 x 10-3 (4) and   8 x 10-3 (4). The composite glass  (AgI)0.7(AgPO3)0.3 crystal structures at pressures of 100, 300 and 700 kg/cm2 have been analyzed by using a Rietveld method.  The refinement results show that the peaks correspond to γ-AgI phase with a symmetry space group F-4 3 m No. 216, FCC, with the lattice constant namely 6.518(3), 6.508(3) and 6.506Ǻ(2) at a pressure of  100, 300 and 700 kg/cm2 respectively.  The increasing of microstrain (η), and crystal size (D) and the decreasing of lattice constant (a) will increase the ionic mobility, thus increasing the ionic conductivity. The function of pressure on melt γ-AgI phase into glass matrix AgPO3 decreases the lattice constant and the crystal size, cause the increasing  of microstrain  broadening and ionic conductivity
STUDI AWAL DEPOSISI LAPISAN TIPIS YTTRIA-STABILIZED ZIRCONIA (YSZ) PADA SUBSTRAT BAJA FERITIK DENGAN METODE PLD - PULSED LASER DEPOSITION Agusutrisno, Agusutrisno; Suharyadi, Edi; Mardiyanto, Mardiyanto; Rivai, Abu Khalid
Jurnal Spektra Vol 16, No 1 (2015): Spektra: Jurnal Fisika dan Aplikasinya
Publisher : Jurnal Spektra

Show Abstract | Original Source | Check in Google Scholar

Abstract

AbstrakStudi awal lapisan tipis Yttria-Stabilized Zirconia (YSZ) telah berhasil dideposisi di atas substrat baja feritik dengan teknik Pulsed Laser Deposition (PLD) di fasilitas laboratorium Pusat Sains dan Teknologi Bahan Maju - BATAN. Lapisan tipis ini dideposisi dengan tekanan chamber dalam rentang 200 mTorr hingga 225 mTorr dengan temperatur substrat pada temperatur ruang serta pulsa tembakan laser adalah 30×1000 tembakan dengan frekuensi 10 Hz. Selanjutnya sampel yang diperoleh dianalisis dengan Optical Microscope (OM), X-Ray Diffractometer (XRD), Raman Spectrometer dan Atomic Force Microscope (AFM). Sebagai bahan perbandingan sampel tersebut dipanaskan (annealing) pada temperatur 800oC kemudian dikarakterisasi dengan metode yang sama. Hasil analisis secara visual maupun dengan OM serta AFM menunjukkan bahwa lapisan YSZ telah terdeposisi di atas permukaan substrat baik sebelum dipanaskan maupun setelah dipanaskan. Karakterisasi struktur kristal sampel menggunakan X-ray Diffraction (XRD) menunjukkan bahwa derajat kristalinitas lapisan tipis YSZ masih rendah baik dengan substrat dipanaskan maupun tanpa dipanaskan. Karakterisasi Raman Spectroscopy menunjukkan bahwa pada deposisi dengan temperatur ruang belum tampak dengan jelas ikatan dan fasa YSZ. Sedangkan pada sampel dengan substrat dipanaskan menghasilkan puncak pada 550 cm-1 yang menunjukkan bahwa lapisan cenderung amorf. Karakterisasi topografi permukaaan menggunakan AFM menunjukkan bahwa sampel yang dideposisi menggunakan teknik PLD menghasilkan surface roughness yang sangat halus dalam rentang nano-meter sehingga berpotensi digunakan sebagai aplikasi Thermal Barrier Coating (TBC) pada material temperatur tinggi.Kata kunci: Lapisan tipis, Yttria-Stabilized Zirconia (YSZ), Pulsed Laser deposition (PLD), baja, nano-meter AbstractPRELIMINARY STUDY OF A YTTRIA-STABILIZED ZIRCONIA (YSZ) THIN FILM DEPOSITION ON A FERRITIC STEEL SUBSTRATE USING PLD - PULSED LASER DEPOSITION METHOD. A thin film of Ytrria-Stabilized Zirconia has been deposited on a ferritic stainless steel by Pulsed Laser Deposition (PLD) at laboratory facilities of Center For Science and Technology of Advanced Materials-BATAN. The thin film was deposited with the chamber pressure range of 200 mTorr to 225 mTorr, substrate temperature at room temperature, and 30x1000 shots of pulsed-laser with 10 Hz of frequency. Afterward, the sample was analyzed using Optical Microscope (OM), X-Ray Diffractometer (XRD), Raman Spectrometer and Atomic Force Microscope (AFM). As for comparison analysis, the sample was annealed at 800oC then characterized using the same methods. The result of analyses with visually and using OM then AFM showed that the thin film of YSZ was deposited on the surface of the substrate. The characterization of the crystal structure of the sample by using XRD showed that the crystallinity degree of thin film with the substrate both with and without annealing was still low. Raman spectroscopy characterization showed that the bond and phase of YSZ deposition with the substrate at room temperature were not clearly formed. Whereas the sample was annealed resulted peak at 550 cm-1, which is showed that the thin film was still amorphous. Surface topography characterization using AFM showed that the surface roughness of the sample deposited by PLD method was relatively smooth in the range of nano-meter.Keywords: Thin film, Yttria-Stabilized Zirconia (YSZ), Pulsed Laser Deposition (PLD), steel, nano-me
KARAKTERISASI PENGARUH DOPAN Mn PADA BAHAN KERAMIK PIEZOELEKTRIK LEAD ZIRCONIUM TITANATE (Pb[ZrxTi1-x]O3) Mardiyanto, Mardiyanto; Ahda, Syahfandi
Jurnal Sains Materi Indonesia Vol 15, No 2: JANUARI 2014
Publisher : BATAN

Show Abstract | Original Source | Check in Google Scholar | Full PDF (441.104 KB)

Abstract

KARAKTERISASI PENGARUH DOPAN Mn PADA BAHAN KERAMIK PIEZOELEKTRIK LEAD ZIRCONIUM TITANATE (Pb[ZrxTi1-x]O3). Telah dilakukan penelitian pembuatan bahan piezoelctrik Lead Zirconium Titanate (PZT) yang diberi bahan dopan Mn. Penambahan bahan dopan ini bertujuan untuk menaikkan sifat pizoelektrisitas dari PZT. Senyawa yang dianalisa pada penelitian ini adalah Pb[Zr0,5Ti0,5-xMnx]O3, dengan harga x (nominal) bernilai 0,05; 0,125; 0,25; 0,35. Hasil analisis menunjukkan bahan dengan dopan Mn ini diperoleh peningkatan suhu curie berkisar antara 15 sampai 35 oC. Namun konstanta dielektrikum menjadi turun dibandingkan dengan PZT murni.
Rancang Bangun Sistem Informasi Pengawasan Pelaksanaan Pekerjaan Studi Kasus PT. PLN Area Surabaya Utara Mardiyanto, Mardiyanto; Pattiasina, Timothy John; Setyoadi, Eddy Triswanto
Teknika Vol 5 No 1 (2016): November 2016
Publisher : Pusat Penelitian dan Pengabdian Kepada Masyarakat, Institut Informatika Indonesia

Show Abstract | Original Source | Check in Google Scholar | Full PDF (1781.748 KB)

Abstract

Sistem informasi berbasis komputerisasi merupakan salah satu faktor penting bagi perusahaan dalam mengelola segala aktifitasnya. Dalam hal ini, penerapan sistem informasi khususnya dalam pengawasan pekerjaan atau Surat Perintah Kerja (SPK) di perusahaan yang bergerak dalam pengelolaan proyek pekerjaan yang bekerjasama dengan pihak ketiga yang disebut juga dengan vendor atau mitra kerja masih sangat minim. Sistem Informasi Pengawasan Pelaksanaan Pekerjaan di PT PLN Area Surabaya Utara adalah suatu sistem yang dapat mengelola pendistribusian informasi pelaksanaan pekerjaan dan mampu menginformasikan status dari pelaksanaan pekerjaan tersebut. Sistem ini dibangun untuk mempermudah manajemen dalam mengelola pengawasan pelaksanaan pekerjaan atau Surat Perintah Kerja yang ada pada perusahaan. Selain itu sistem ini mampu memberikan notifikasi serta pengingat terhadap deadline pekerjaan melalui aplikasi berbasis XMPP yaitu Cangkruk yang sudah diterapkan di PT PLN Area Surabaya Utara.
Pengembangan Metode Identifikasi Dna (Pij702) Menggunakan Prinsip Lisis Alkali dan Pengendapan dengan Natrium Asetat pH 2 Untari, Budi; Mardiyanto, Mardiyanto
Jurnal Penelitian Sains No 14 (2003)
Publisher : Faculty of Mathtmatics and Natural Sciences

Show Abstract | Original Source | Check in Google Scholar | Full PDF (3563.343 KB)

Abstract

Telah dilakukan perbaikan visualisasi plasmid bermarka melanin (pIJ 702) pada Streptomyces lividans Rekombinan dengan modifikasi metode lisis alkali. Larutan netrium asetat yang digunakan untuk mengendapkan DNA dalam metode lisis alkali didapat pada pH 2 memberikan hasil yang terbaik dalam menvisualisasikan pita plasmid pIJ 702. Dengan perendaman etidium bromida (50 mg dalam 50 mL air) lebih dari waktu normal juga tidak memperlihatkan melanin pengganggu, sedangkan larutan buffer penyimpan yang di dapat pada pH di bawah 7 tidak memberikan pengaruh yang berarti (p = 0,05). Hasil visualisasi fragmen Bam H1 plasmid pIJ 702 juga jelas pertanda metoda bebas dari pengaruh melanin. 
Rancangan Primer Untuk Aplikasi Gen Pengkode Kitinase dari Bacillus Substillis Mardiyanto, Mardiyanto; Yusuf, Setiawan
Jurnal Penelitian Sains Vol 10, No 1 (2007)
Publisher : Faculty of Mathtmatics and Natural Sciences

Show Abstract | Original Source | Check in Google Scholar | Full PDF (4505.191 KB)

Abstract

Telah dilakukan penelitian tentang perancangan primer untuk aplifikasi gen pengkode kitinase dari Bacillus substillis. Hasil perancangan dan amplifikasi akan dipergunakan untuk proses overproduksi kitinase yang akan dimanfaatkan pada bidang kesehatan dan pertanian. Dari proses perancangan diketahui bahwa gen pengkode kitinase dari Bacillus substillus ditemudi cds tidak dimulai dari basa pertama dan ada 186 basa dihitung dari strat kodon, primer yang dihasilkan tidak memperlihatkan empat basa yang berurutan menempel pada kondisi self dimmer ataupun hair pin loop. Urutan primer yang siperoleh adalah Forward aaaagggggtgaacaaaatagagt dan Revearese acacggtcgtcgtcagcaagta
Isolasi Sekreted Amylase dari Streptomyces Lividans yang Ditumbuhkan pada Media Minim Protein Yusuf, Setiawati; Mardiyanto, Mardiyanto
Jurnal Penelitian Sains No 13 (2003)
Publisher : Faculty of Mathtmatics and Natural Sciences

Show Abstract | Original Source | Check in Google Scholar | Full PDF (476.529 KB)

Abstract

Telah dilakukan isolasi sekreted amylase dari Streptomyces lividans yang ditumbuhkan dalam media yang minim protein. Pola fragmentasi protein sekreted amylase hasil fraksinasi 50% ammonium sulfat diuji dengan SDS-PAGE (Sodium Dodecyl Sulphate-Poly Acrylamide Gel Electrophoresos) sedangkan pemisahan serta deteksi sekreted amylase dilakukan dengan metode antibody traped. Sekreted amylase dengan konsentrasi 50 ng/ml terdeteksi oleh antibodi sedangkan konsentrasi 120 ng/ml memperlihatkan noda optimal.
Optimasi Formula Submikro Partikel Poly (Lactic-co-Glycolic Acid) Pembawa Betametason Valerat dengan Variasi Konsentrasi Poly (Vinyl Alcohol) dan Waktu Sonikasi Mardiyanto, Mardiyanto; Fithri, Najma Anuria; Raefty, Winesfin
JSFK (Jurnal Sains Farmasi & Klinis) Vol 5, No 1 (2018): J Sains Farm Klin 5(1), April 2018
Publisher : Fakultas Farmasi Universitas Andalas

Show Abstract | Original Source | Check in Google Scholar | Full PDF (606.315 KB)

Abstract

Preparation of betamethasone valerate (BMV) into submicro particle aims to resolve the solubility problem (Biopharmaceutics Classification System II) and to increase penetration through the skin. The method of emulsion solvent evaporation is used in preparing BMV encapsulated by PLGA (Poly (Lactic-co-Glycolic Acid) as polymer and PVA Poly (Vinyl Alcohol) as stabilizer. The proportion of optimum formula components obtained were 50 mg PVA and 10 minutes sonication time with the response values which resulted %EE of 73.000%, pH of 4.800, and %weight of BMV on stability test of 62.057%.The resulting diameter, PDI (poly dispersity ndex), and zeta potential analysis of the optimum formula were 342.700 nm, 0.104, and -12.200 mV respectively. Result from the particle morphology using Transmission Electron Microscopy showed spheric shape particle. The diffusion test showed the highest diffusion percent value on submicro particles of PLGA-BMV (23.067% ± 0.055) compared with pure BMV (18.007% ± 0.002) and comercial BMV cream (19.506%± 0,071). Analysis of the dissolution rate showed that submicro particles of PLGA-BMV (84.211% ± 1.943) increased the amount of drug released compared to pure BMV (10.912% ± 0.246). The release rate and mechanism of PLGA-BMV followed zero order.