
Found 34 Documents

Karakteristik dan Patogenisitas Streptococcus Agalactiae Tipe ?-hemolitik dan Non-hemolitik pada Ikan Nila

Jurnal Veteriner Vol 12, No 2 (2011)
Publisher : Jurnal Veteriner

Show Abstract | Original Source | Check in Google Scholar


Streptococcus agalactiae was isolated from cultured Nile tilapia (Oreochromis niloticus) in Cirata gulfand Klaten. The isolates were Gram positive cocci, oxidative fermentative positive, motility, and catalasenegative, grown on media containing NaCl 6.5%, ?-haemolytic and non-haemolytic. Two types of S. agalactiae(?-haemolytic and non-haemolytic) are different from their variety of sugars fermentation. Strains ?-haemolytic can ferment more sugars, including arabinose, sorbitol, lactose, and trehalose. Experimentalinfectivity trials on Nile tilapia (size 15 g), non-haemolytic type showed more virulent. This type causedfaster mortality, more severe behavior changes, and pathology changes than â-haemolytic type. NonhemoliticS. agalactiae caused 48% mortality 6-24 hours after injection, whereas â-haemolitic type caused17% mortality which it occured in 48 hours after injection (mortality of fish control 2,22%). Behaviordisease signs caused by non-haemolitic S. agalactiae started to happen 6 hours after injection whereas 12hours in ?-haemolytic type infection. Histopatological changes were observed on fish eye, spleen, andbrain. Hyperaemia, hyperthrophi, degeneration, and necrosis were also found on infected fish. Thisresearch was concluded that non-haemolytic of S. agalactiae was more virulent than ?-haemolytic.

Enhancement of non-specific immune response, resistance and growth of (Litopenaeus vannamei) by oral administration of nucleotide

Jurnal Akuakultur Indonesia Vol 10, No 1 (2011): Jurnal Akuakultur Indonesia
Publisher : Jurnal Akuakultur Indonesia

Show Abstract | Original Source | Check in Google Scholar | Full PDF (207.428 KB)


This research evaluated the nonspecific immune responsse, resistance, and growth of Litopenaeus vannamei fed nucleotide diet. Shrimp juveniles (mean weight 5.39±0.56 g) were reared in two groups of glass aquaria, each with three replications. Shrimps in group one and group two were fed nucleotide diet and basal diet each for four weeks. Total haemocyte count (THC) and PO activity were evaluated at the end of feeding while growth was measured at two weeks interval. At the end of feeding trial, the shrimps were intramuscularly injected with Vibrio harveyi 0.1x106 cfu.shrimp-1. THC of shrimp fed nucleotide diet significantly increased (P

Feed efficiency improvement and aquaculture waste conversion to economically valuable product

Jurnal Akuakultur Indonesia Vol 9, No 2 (2010): Jurnal Akuakultur Indonesia
Publisher : Jurnal Akuakultur Indonesia

Show Abstract | Original Source | Check in Google Scholar | Full PDF (324.32 KB)


Fish farmer cannot reduce feed price, however they can reduce feed cost for fish producing. Feed cost is highly determined by feeding rate (FR); whether in maximum FR or restricted FR, and dissolved oxygen level in water. The present paper reviews a detail explanation concerning both factors on feed efficiency. Amongst other water quality parameters, oxygen is the most important factor and therefore must be closely monitored. Moreover, dissolved oxygen cannot be detected only by visual observation. Biofloc technology and PAS (partitioned aquaculture system) can change waste into bacteria and phytoplankton biomass which can be further utilized as fish feed. The major difference between these systems is in the oxygen requirement. This paper also presents some experiment results and preliminary applications in field scale that have been performed in Indonesia.Keywords: feeding rate, oxygen, feed efficiency. ABSTRAKPembudidaya ikan tidak bisa menurunkan harga pakan, tetapi dapat menurunkan biaya pakan untuk memproduksi ikan. Biaya pakan sangat ditentukan oleh feeding rate (FR); apakah ”maksimum FR” atau ”restricted FR”, dan oksigen terlarut dalam air. Dalam artikel ini diuraikan secara rinci mengenai pengaruh kedua faktor tersebut terhadap efisiensi pakan. Oksigen merupakan faktor yang paling penting di antara kualitas air, oleh karena itu kadar oksigen terlarut harus diukur. Oksigen terlarut tidak dapat dideteksi dengan panca indera manusia. Teknologi biofloc dan PAS (partitioned aquaculture system) mampu mengubah limbah jadi bakteri dan fitoplankton yang siap untuk menjadi makanan ikan. Perbedaannya antara kedua sistem terletak pada kebutuhan oksigen. Artikel ini juga memuat hasil percobaan dan praktik rintisan skala lapangan yang telah dilaksanakan di Indonesia.Kata kunci: feeding rate, oksigen, efisiensi pakan.

Kandidat Vaksin Potensial Streptococcus agalactiae untuk Pencegahan Penyakit Streptococcosis pada Ikan Nila (Oreochromis niloticus) (POTENTIAL VACCINE CANDIDATE OF STREPTOCOCCUS AGALACTIAE FOR PREVENT STREPCOCOCOSIS ON NILA TILAPIA (OREOCHROMIS NILOTICUS)

Jurnal Veteriner Vol 14, No 4 (2013)
Publisher : Jurnal Veteriner

Show Abstract | Original Source | Check in Google Scholar


The effectiveness of Streptococcus agalactiae vaccine in tilapia (Oreochromis niloticus) was evaluatedfor prevention of streptococcal disease. The vaccine was prepared using formalin-killed whole cell andconcentrated extracellular products/ECP (62.3 and 55.8 kDa) of â-haemolityc isolate and 62.3; 55,8 and51.8 kDa protein of  non-haemolityc ECP of S. agalactiae.  Vaccination and challenged (103 colony-formingunits (CFU)/fish of â-haemolityc and 105 CFU/fish of non-haemolityc S. agalactiae) trial was conducted byintraperitonial (IP) injection into fish with average body weight of 15 g.  Fish were vaccinated with wholecell, ECP and mixed (whole cell and ECP) vaccine.  Tilapia vaccinated with whole cell of â-haemolitycisolate had a relative percent survival (RPS) rates higher than those of ECP â-haemolityc vaccine. However,fish  vaccinated with mixed (whole cell and ECP) of â-haemolityc has a better protection rates as comparedto those of two type of S. agalactie infection. Whereas those vaccinated with mixed (whole cell non-haemolitycand ECP of â-haemolityc) vaccine has protection rate of 79% from â-haemolityc and 42% from non-haemolitycinfection.  Tilapia vaccinated with whole cell of non-haemolityc was only able to protect fish from non-haemolityc infection and was unable to protect fish from other types.  Tilapia vaccinated with ECP non-haemolityc had a worse RPS than others vaccines in which mix whole cell and ECP vaccine of non-haemolitychad a protection 50-56% from  S. agalactiae infection. Whereas vaccinated with mixed (whole cell â-haemolityc and ECP of non-haemolityc) vaccine showed a better to protect from â-haemolityc than non-haemolityc infection.  It showed thatvaccination with mixed (whole-cell and extracellular product)  vaccineof S. agalactiae â-haemolityc  was more effective to protect tilapia against Streptococcosis.

Molecular identification of pathogenic bacteria and PCR specific primer design

e-Journal BUDIDAYA PERAIRAN Vol 1, No 3 (2013)
Publisher : e-Journal BUDIDAYA PERAIRAN

Show Abstract | Original Source | Check in Google Scholar | Full PDF (112.34 KB)


Management of healthy seaweed aquaculture and control of ice ice disease are important component in seaweed production. To support the integrated prevention of ice ice disease, information about genetic variation of bacterial pathogen and the availability of fast and accurate detection are required. This study aimed to identify bacterial pathogen based on gene sequence analysis 16S-rRNA, construction of specific PCR primer from gene sequent analysis 16S-rRNA from bacteria that had the highest pathogenicity. Gene 16S rRNA of bacteria that had the highest pathogenicity was amplificated with universal primer PCR domain forward primer 63f (5’-CAG GCC TAA CAC ATG CAA GTC-3’) and reverse primer 1387r (5’-GGG CGG WGT GTA CAA GGC-3’). DNA Sequence obtained was compared to data base European Bioinformatics Institute (EBI) BLASTN. Construction and feasibility analysis of primer pair was done using primer 3 program. Two specific primer PCR were successfully constructed namely aSEFM-F (5- CAGCCACACTGGAACTGAGA-3) and aSEFM-R(5 TTAGCCGGTGCTTCTTCTGT -3). Both primer reacted optimum at 60°C and produced 201 bp amplicon. Keywords: pathogenicity, gene 16S-rRNA, PCR, primer, specific

Isolation and characterization of pathogenic Vibrio on tiger grouper Epinephelus fuscoguttatus

Jurnal Akuakultur Indonesia Vol 11, No 1 (2012): Jurnal Akuakultur Indonesia
Publisher : Jurnal Akuakultur Indonesia

Show Abstract | Original Source | Check in Google Scholar | Full PDF (1133.598 KB)


This study was aimed to obtain pathogenic bacterial isolate causing vibriosis disease. Isolation of Vibrio was conducted from maribound tiger grouper collected from floating net cage in Barru Regency using TCBS medium. Ability to cause vibriosis was confirmed by pathogenicity test performed by mean injecting the tiger grouper juveniles with bacterial suspension at concentration of 106 CFU/fish and mortality of fish during seven days observation then was noted. Then, the Vibrio pathogenic isolate was characterized and identified based on morphology, growth, and biochemical features. Moreover, the most pathogenic isolate was identified by molecular analysis of 16S-rRNA gene sequences. The results showed that three potential isolates caused Vibriosis disease in tiger grouper culture. The isolates tested were biochemically identified as Vibrio metschnikovii, V. parahaemolyticus, and V. mimicus. The most virulent among isolates was V. parahaemolyticus. Keywords: isolation, characterization, pathogenic, vibriosis, tiger grouper

Pemberian Fikosianin Spirulina Meningkatkan Jumlah Sel Darah, Aktivitas Fagositosis, dan Pertumbuhan Ikan Kerapu Bebek Juvenil (ADMINISTRATION OF SPIRULINA PHYCOCYANIN ENHANCES BLOOD CELLS, PHAGOCYTIC ACTIVITY AND GROWTH IN HUMPBACK GROUPER JUVENILE)

Jurnal Veteriner Vol 15, No 1 (2014)
Publisher : Jurnal Veteriner

Show Abstract | Original Source | Check in Google Scholar


The aim of this study was to investigate effects of Spirulina phycocyanin on the total  blood cell count,phagocytic activity, and growth of humpback grouper fish, Cromileptes altivelis juvenil.  Fishes were fedwith a diet containing   0, 150, 250, 350 dan 450 mg  phycocyanin per kg diet for four weeks and eachtreatment was triplicates.  Initial body weight  of  grouper was  8.46 ± 0.22 g with a density of 10 fish per56 litre volume. The total count of  erythrocytes and leucocytes increased until the fourth week of rearingperiod. The highest of total erythrocyte and leucocytes were observed in fish treated with 150 mg phycocyaninper kg diet ( 13.17 x  105 cells/mm3 and 8.93 x 105 cells/mm3 respectively) which were not significantlydifferent (P>0.05) to those treated with 250 mg phycocyanin per kg diet. The total leucocytes and phagocyticactivity of fish fed diet containing  250 mg phycocyanin  per kg diet (8.49 x 105 cells/mm3 and 59.67%respectively) were significantly higher  (P <0.05) to those of control group. The highest of final weight(Wt=14.32 g) and weight growth (G=5.89g) and lowest of feed conversion ratio (FCR=1.13) were obtainedin fish treated with  250 mg phycocyanin per kg diet which were  significantly  higher  (P <0.05) than thosefed control diet. The data showed that  the addition of  phycocyanin 250 mg/kg diet enhances the totalleukocyte count, phagocytic activity and the growth of humpback grouper juvenil.

Protein digestibility and ammonia excretion in catfish Clarias gariepinus culture

Jurnal Akuakultur Indonesia Vol 12, No 1 (2013): Jurnal Akuakultur Indonesia
Publisher : ISSA

Show Abstract | Original Source | Check in Google Scholar | Full PDF (2783.567 KB)


ABSTRACT A series of experiments was performed to analyze protein digestibility, ammonia excretion, and also heterothropic bacteria and phytoplankton dynamics in the catfish Clarias gariepinus culture. In the digestibility experiment, catfish with an individual initial size of 43.67±0.83 g were stocked into 120 L conical fiberglass tanks at a density of 20 fish per tank. Fish were fed on with commercial diet supplemented with Cr2O3 indicator at a concentration of 1%. In the ammonia excretion experiment, catfish with an individual size of 111.6±9.5 and 40.6±3.4 g, respectively,  were placed into a 10 L chamber filled with 8 L of water. Total ammonia nitrogen (TAN) in the chambers were monitored every hour for six consecutive hours. In the bacteria and phytoplankton dynamics experiment, catfish were stocked in the 25 m2 concrete tanks which was divided into two compartments (catfish 10 m2, and heterotrof compartments 15 m2). Catfish with individual size of 42,5±0 g were stocked into the tanks at a density of 100 fish per tank. Water was recirculated from catfish compartments to heterotrophic compartments. Fish were fed with floating feed. Molasses as carbon source for heterotrophic bacteria was applied daily. The experiment was conducted for six weeks. The results showed that the protein digestibility was 61.97±7.24%. Larger fish (size of 111.6 g) excreted ammonia at a rate of 0.008±0.003 mg TAN/g fish-weight/hour, which was lower than that of the smaller catfish (size of 40.6 g), i.e. 0.012±0.004 mg TAN/g fish-weight/hour. Keywords: protein digestibility, ammonia excretion, catfish  ABSTRAK Serangkaian penelitian telah dilakukan untuk menganalisis ketercernaan pakan dan protein, ekskresi amonia, serta dinamika bakteri dan fitoplankton pada budidaya ikan lele (Clarias gariepinus). Pada penelitian ketercernaan pakan, ikan lele berukuran 43,67±0,83 g/ekor dipelihara dalam bak fiberglas berbentuk corong berukuran 120 L dengan kepadatan 20 ekor/bak. Ikan diberi pakan berupa pelet yang diberi indikator Cr2O3 sebanyak 1%. Pada penelitian ekskresi amonia, ikan lele berukuran 111,6±9,5 dan 40,6±3,4 g/ekor yang telah diberi makan sampai kenyang dimasukkan ke dalam stoples berisi 8 L air. Kadar amonia total (total ammonia nitrogen, TAN) di dalam stoples diukur setiap jam selama enam jam. Pada penelitian dinamika bakteri dan fitoplankton, ikan lele dipelihara pada bak beton berukuran 25 m2 yang disekat menjadi dua bagian yaitu bagian ikan lele (10 m2) dan bagian heterotrof (15 m2). Ikan lele dengan bobot awal 42,5 g/ekor ditebar ke dalam bak dengan kepadatan 100 ekor/bak. Air mengalir secara resirkulasi dari bagian ikan lele ke bagian heterotrofik dengan bantuan pompa. Pakan yang diberikan berupa pelet apung komersial. Molase ditambahkan setiap hari sebagai sumber karbon untuk pertumbuhan bakteri heterotrofik. Penelitian dilaksanakan selama enam minggu. Hasil pengamatan menunjukkan bahwa ketercernaan protein dari pakan yang diuji adalah 61,97±7,24%. Ikan lele berukuran besar (111,6 g/ekor) menghasilkan amonia sebanyak 0,008±0,003 mg TAN/g ikan/jam, lebih rendah dibandingkan dengan ikan yang berukuran lebih kecil (40,6 g/ekor), yaitu 0,012±0,004 mg TAN/g ikan/jam.  Kata kunci: ketercernaan protein, ekskresi amonia, ikan lele

The effectiveness of Lemna perpusilla as phytoremediation agent in giant gourami culture media on 3 ppt

Jurnal Akuakultur Indonesia Vol 14, No 2 (2015): Jurnal Akuakultur Indonesia
Publisher : ISSA

Show Abstract | Original Source | Check in Google Scholar | Full PDF (2761.984 KB)


ABSTRACT The wasted from feed and feces containt nitrogen and phosphorus can decreased fertility and feability water quality. Lemna perpusilla (duckweed) is prospective to use as an agent of phytoremediation of organic waste and can used as animal feed because it has high protein content. Meanwhile water salinity could be accelerate the growth of giant gourami. The aim of this research was to analyze the ability of L. perpusilla in absorbing nutrients nitrogen and phosphorus in water salinity of 3 ppt. The research was conducted four treatments and three replications. The treatments were A (L. perpusilla and 3 ppt salinity), B (L. perpusilla, 3 ppt salinity and filter), C (L. perpusilla, 3 ppt salinity and aeration), and D (L. perpusilla, 3 ppt salinity, filter and aeration). Experiment were carried in aquaria 50×33×50 cm3 in size with density of gourami fish 150/49.5 L for one month. The results showed that the ability of L. perpusilla to absorb N and P decreased from the beginning of the study due to lack of nutrient source of N and P in the aquaculture media, but increased because the impact of the feeding and  metabolism of the gourami. There was no different treatment effect for decreased N and P (P> 0.05). The highest nitrite level was found in D treatment, it means that L. perpusilla not be able to absorb  N and P in the media 3 ppt salinity. However, the addition of 3 ppt salinity gives the best results for the survival rate and feed efficiency ratio. Keywords: phytoremediation, Lemna perpusilla, giant gourami fish, nitrogen and phosphorus  ABSTRAK Limbah pakan dan feses yang mengandung nitrogen dan fosfor dapat menyebabkan penurunan kesuburan dan kelayakan kualitas air. Lemna perpusilla (duckweed) baik digunakan sebagai agen fitoremediasi organik untuk limbah dan dapat digunakan sebagai pakan hewan karena mengandung protein yang tinggi, sementara media bersalinitas mampu mempercepat pertumbuhan ikan gurami. Tujuan dari penelitian ini adalah untuk menganalisis kemampuan L. perpusilla dalam mengabsorbsi nutrisi nitrogen dan fosfor pada air bersalinitas 3 ppt. Penelitian ini terdiri atas lima perlakuan dan tiga ulangan. Perlakuan yang diberikan adalah A (L. perpusilla dan salinitas 3 ppt), B (L. perpusilla, salinitas 3 ppt dan filter), C (L. perpusilla, salinitas 3 ppt dan aerasi), dan D (L. perpusilla, salinitas 3 ppt, aerasi dan filter). Akuarium yang digunakan berukuran 50×33×50 cm3 dengan kepadatan ikan gurami 150 ekor/49,5 L dan waktu pemeliharaan selama satu bulan. Hasil penelitian ini menunjukkan bahwa kemampuan L. perpusilla menyerap limbah N dan P berkurang dari awal penelitian karena kurangnya sumber nutrisi N dan P pada media pemeliharaan, namun beranjak meningkat yang berdampak dari adanya pemberian pakan dan sisa metabolisme dari ikan gurame. Tidak ada perlakuan yang berpengaruh terhadap pengurangan N dan P (P>0,05). Nilai nitrit tertinggi terdapat pada perlakuan D, hal ini berarti bahwa L. perpusilla tidak mampu untuk menyerap limbah N dan P pada media bersalinitas 3 ppt. Namun penambahan salinitas 3 ppt memberikan hasil yang terbaik bagi derajat kelangsungan hidup ikan gurami dan efisiensi pakan. Kata kunci: fitoremediasi, Lemna perpusilla, ikan gurami, nitrogen dan fosfor 

Feed efficiency improvement and aquaculture waste conversion to economically valuable product

Jurnal Akuakultur Indonesia Vol 9, No 2 (2010): Jurnal Akuakultur Indonesia
Publisher : ISSA

Show Abstract | Original Source | Check in Google Scholar | Full PDF (324.32 KB)


Fish farmer cannot reduce feed price, however they can reduce feed cost for fish producing. Feed cost is highly determined by feeding rate (FR); whether in maximum FR or restricted FR, and dissolved oxygen level in water. The present paper reviews a detail explanation concerning both factors on feed efficiency. Amongst other water quality parameters, oxygen is the most important factor and therefore must be closely monitored. Moreover, dissolved oxygen cannot be detected only by visual observation. Biofloc technology and PAS (partitioned aquaculture system) can change waste into bacteria and phytoplankton biomass which can be further utilized as fish feed. The major difference between these systems is in the oxygen requirement. This paper also presents some experiment results and preliminary applications in field scale that have been performed in Indonesia.Keywords: feeding rate, oxygen, feed efficiency. ABSTRAKPembudidaya ikan tidak bisa menurunkan harga pakan, tetapi dapat menurunkan biaya pakan untuk memproduksi ikan. Biaya pakan sangat ditentukan oleh feeding rate (FR); apakah ”maksimum FR” atau ”restricted FR”, dan oksigen terlarut dalam air. Dalam artikel ini diuraikan secara rinci mengenai pengaruh kedua faktor tersebut terhadap efisiensi pakan. Oksigen merupakan faktor yang paling penting di antara kualitas air, oleh karena itu kadar oksigen terlarut harus diukur. Oksigen terlarut tidak dapat dideteksi dengan panca indera manusia. Teknologi biofloc dan PAS (partitioned aquaculture system) mampu mengubah limbah jadi bakteri dan fitoplankton yang siap untuk menjadi makanan ikan. Perbedaannya antara kedua sistem terletak pada kebutuhan oksigen. Artikel ini juga memuat hasil percobaan dan praktik rintisan skala lapangan yang telah dilaksanakan di Indonesia.Kata kunci: feeding rate, oksigen, efisiensi pakan.