
Found 26 Documents

Jurnal Sain Veteriner Vol 19, No 2 (2001): en
Publisher : Fakultas Kedokteran Hewan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (71.575 KB)


Penelitian ini bertujuan untuk mengetahui pengaruh injeksi _protein membran sporozoit Eimeria tenella terhadap Indeks Reproduksi E. tenella pada ayam. Dalam penelitian ini, sebanyak 60 ekor DOC jantan petelur (strain Isa Brown) digunakan sebagai hewan percobaan. Ayam percobaan tersebut setelah berumur 4 hari dibagi acak menjadi tiga kelompok (kelompok kontrol, I dan II), masing-masina kelompok terdiri dari 20 ekor. Ayam-ayam pada kelompok I diinjeksi dengan protein membran sporozoit E tenella dengan dosis 2,1 jig per ekor secara intravena. Ayam-ayam pada kelompok [1. dinjeksi secara intrakutan dengan protein yang sama seperti yang diinjeksikan pada kelompok I, sedang ayam pada kelompok kontrol tidak dilakukan perlakuan. Semua ayam percobaan kemudian dimasukkan ke dalam kelompoknya masing-masing dan diberi pakan non koksidiostat dan air minum secara ad libitum. Pada hari ke-22 setelah perlakuan, semua ayam pereobaan diinfeksi dengan 1500 oosista iafektifE tenella per ekor sebagai infeksi tantangan. Data jumlah oosista per gram feses dikumpulkan mtdai hari ke-4 sarnpai dengan hari ke-11 setelah infeksi ta.ntangan. Hasil perhitungan Indeks Reproduksi dianalisis secara deskriptif Dari hasil penelitian ini dapat ditarilc ksimpulan bahwa injeksi 2,1 pg protein membran sporozoit E. tenella baik secara intravena maupun intrakutan tidak mempengaruhi Indeks Reproduksi El tenella pada ayam-ayam percobaan terhadap infeksi taniangan E. tenellcr.
STUDI EKSPERIMENTAL SISTA JARINGAN Toxoplasma gondii SECARA IN VIVO AN EXPERIMENTAL STUDY OF Toxoplasma gondii TISSUE CYST IN VIVO ., M.Hanafiah; Nurcahyo, Wisnu; ., Sumartono
Jurnal Sain Veteriner Vol 21, No 2 (2003)
Publisher : Fakultas Kedokteran Hewan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (71.575 KB)


Diagnosis Molekuler Toxoplasma gondii Berdasar Gen Stage Spesifik Takizoit dan Bradizoit pada Ayam Kampung (MOLECULAR DIAGNOSIS OF TOXOPLASMA GONDII BASED ON THE TACHYZOITE AND BRADYZOITE STAGE SPECIFIC GENES IN FREE-RANGE CHICKEN) Apsari, Ida Ayu Pasti; Artama, Wayan Tunas; ., Sumartono; Damriyasa, I Made
Jurnal Veteriner Vol 13, No 1 (2012)
Publisher : Jurnal Veteriner

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (71.575 KB)


The aims of this study was to determine the presence of Toxoplasma gondii in free-rangechicken using Polymerase Chain Reaction (PCR) method based on the tachyzoite and bradyzoitestage specific genes. SAG1 and BAG1 are the tachyzoite and bradyzoite stage-specific gene respectively.The primers for SAG1 and BAG1 were designed using Web-base Program Primer 3. Genomic DNAfrom free-range chicken heart and brain was isolated using Pure-Link Genomic Isolation Kit.DNA amplification by PCR using primers for SAG1 and BAG1 genes was used for diagnosis ofT.gondii. The results showed that the DNA amplification using primers for SAG1 and BAG1 geneswas successfully applied to determine of Toxoplasma gondii in free-range chicken.
Dimensi Interior Vol 7, No 1 (2009): JUNI 2009
Publisher : Institute of Research and Community Outreach - Petra Christian University

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (71.575 KB)


As can be seen from its ornamental elements, the interior of the Santo Yakobus Surabaya Church expressed meaningful signs. These signs serve as a representation of the Catholic liturgy with universal characteristics that become a reference for the Catholic church design in all over the world. This paper aims to reveal the meanings of these signs from the point of view of Peircean semiotics. In this case, these signs are analyzed through the categories of icon, index, and symbol respectively and then combined with the analyses of denotation, connotation and social aspect. The analyses result that the signs in this church convey meanings not only related to the Catholic liturgy but also local and social contexts.
Sekuen Gen Surface Antigen-1 dan Bradizoit Antigen-1 Takizoit Toxoplasma gondii sebagai Kandidat Pemindai DNA (SAG1 AND BAG1 GENE SEQUENCES ANALYSIS OF TOXOPLASMA GONDII TACHYZOITE AS PROBE CANDIDATE) Apsari, Ida Ayu Pasti; Artama, Wayan Tunas; ., Sumartono; Damriyasa, I Made
Jurnal Veteriner Vol 13, No 4 (2012)
Publisher : Jurnal Veteriner

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (71.575 KB)


Sag1 and bag1 is a gene specific-stage for Toxoplasma gondii tachyzoite and bradyzoite. The purposeof this study was analyze the sequences of sag1 and bag1 tachyzoite genes of local of Toxoplasma gondiiisolate as deoxyribonucleic acid probe candidate. Tachyzoite of local of Toxoplasma gondii isolate used onthis study. Gene sag1 and bag1 gene of Toxoplasma gondii were amplified by PCR, and then sequenced. Theresults showed sag1 fragment gene contained 612 bp and bag 1 contained 470 bp in length. BLAST analysisof sag1 and bag1 gene fragments as probe candidate showed that high specific for Toxoplasma gondii andno significant cross-reaction fragment with host and other parasites. The sequences 136 bp and 98 bpfragments as DNA probe candidate of Toxoplasma gondii sag1 and bag1 respectively.
KLONING DAN EKSPRESI GEN PENYANDI SAGI TOXOPLASMA GONDII ISOLAT LOKAL PADA VEKTOR pGEX-2T Hartati, Sri; Wuryastuti, Hastari; Widada, Joannes Sri; ., Sumartono; Kusumawati, Asmarani
Jurnal Sain Veteriner Vol 22, No 2 (2004)
Publisher : Fakultas Kedokteran Hewan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (71.575 KB)


Kandidat Probe Parsial Genom Eimeria tenella Untuk Optimalisasi Diagnosis Koksidiosis = Probe Candidate of Eimeria tenella Partial Genome to Optimalize Coccidiosis Diagnose ., Sumartono
Jurnal Sain Veteriner Vol 23, No 2 (2005)
Publisher : Fakultas Kedokteran Hewan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (71.575 KB)


Penelitian ini bertujuan untuk mencari kandidat probe yang dapat digunakan untuk mengoptimalisasi diagnosis koksidiosis berdasarkan fragmen genom Eimeria tenella. Kandidat tersebut ditentukan berdasarkan analisis DNA dari 5 isolat Eimeria tenella ( Jepang, Yogya, Magelang, Solo dan Boyolali ). Isolasi DNA dilakukan dengan metode fenol-khloroformisoamilalkohoI, sedang amplifikasi fragmen DNA dilakukan dengan metode PCR menggunakan forward primer GCTGTGGCCAGAGCAAC dan reverse primer CAACTCCATCGGGCCCA. Sekuensing produk PCR yang ukurannya sarna besar dilakukan di laboratorium Eijkman dan analisis sekuen dilakukan dengan Gene-analyser Genetyx-Max versi 9. Kesimpulan penelitian adalah bahwa sekuen GGCACAGTATCCTCCTTCAGGGCAGGGCT CGCACTGGTCAAACGCGGTA CCATT dan GCCTAAA.TTCATGACCACACACTA merupakan kandidat probe parsial genom E. tenella untuk pengembangan diagnosis koksidiosis.
Model Distribusi Monogenea Pada Ikan Nila (Oreochromis niloticus) Di Daerah Istimewa Yogyakarta ., Nurdiyanto; ., Sumartono
Jurnal Sain Veteriner Vol 24, No 2 (2006)
Publisher : Fakultas Kedokteran Hewan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (71.575 KB)


Analisis Homologi Sekuen Fragmen Genom Eimeria tenella Isolat Jepang, Jogja dan Solo ., Sumartono
Jurnal Sain Veteriner Vol 22, No 2 (2004)
Publisher : Fakultas Kedokteran Hewan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (71.575 KB)


Jurnal Sain Veteriner Vol 21, No 2 (2003)
Publisher : Fakultas Kedokteran Hewan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (71.575 KB)

